This inventor holds 3 USPTO granted patents and 2 published patent applications. Top assignee: Jiaxing Anyu Biotechnology Co., Ltd.. Active years: 2020-2022.
Data source: USPTO (United States Patent and Trademark Office) public patent records. Weekly synchronization. How IDiyas builds this profile
Company Filing History:
Years Active: 2020-2022
Title: Xintao Zhong: Innovator in Biotechnology
Introduction
Xintao Zhong is a prominent inventor based in Zhejiang, China. He has made significant contributions to the field of biotechnology, particularly in the development of methods for detecting adenoviruses. With a total of 3 patents, his work has implications for both medical research and agricultural practices.
Latest Patents
One of Xintao Zhong's latest patents is titled "Hexon protein hypervariable region gene sequence of adenovirus and its application." This invention provides a gene sequence that can encode and express adenovirus hexon protein in vitro, represented as SEQ ID NO: 3. The invention also includes a protein translated and expressed by this gene sequence, which is utilized as an antigen to immunize rabbits for obtaining polyclonal antibodies. These antibodies can detect adenovirus with high sensitivity and specificity.
Another significant patent is the "Reagent and method for rapid detection of porcine adenovirus." This invention offers a reagent and a method for detecting porcine adenovirus in samples. The reagent comprises a specific primer pair, with the upstream primer being (5'-3') ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1) and the downstream primer being (5'-3') CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), where Y can be T or C. This reagent and method are characterized by strong specificity and high sensitivity, enabling rapid detection of porcine adenovirus in samples.
Career Highlights
Xintao Zhong is currently associated with Jiaxing Anyu Biotechnology Co., Ltd., where he continues to innovate and contribute to the field of biotechnology. His work is instrumental in advancing the detection methods for various viruses, which is crucial for public health and agricultural biosecurity.
Collaborations
Xintao Zhong collaborates with notable colleagues, including Ping Chen and Na Li. Their combined expertise enhances the research and development efforts at their company.
Conclusion
Xintao Zhong's contributions to biotechnology, particularly in the detection of adenoviruses, highlight his role as an influential inventor. His patents reflect a commitment to advancing scientific knowledge and improving diagnostic methods.
Data source: USPTO (United States Patent and Trademark Office) public patent records. Weekly synchronization. How IDiyas builds this profile