The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.

The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.

Date of Patent:
Aug. 24, 2021

Filed:

Oct. 29, 2018
Applicant:

Jiaxing Anyu Biotechnology Co., Ltd., Zhejiang, CN;

Inventors:

Ping Chen, Zhejiang, CN;

Na Li, Zhejiang, CN;

Xintao Zhong, Zhejiang, CN;

Tingting Zhang, Zhejiang, CN;

Nan Li, Zhejiang, CN;

Assignee:
Attorney:
Primary Examiner:
Int. Cl.
CPC ...
C12Q 1/68 (2018.01); C12Q 1/70 (2006.01);
U.S. Cl.
CPC ...
C12Q 1/701 (2013.01); C12Q 2600/16 (2013.01);
Abstract

The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5'-3′) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5′-3′) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples.


Find Patent Forward Citations

Loading…