This inventor holds 1 USPTO granted patent. Top assignee: Animatus Biosciences, LLC. Active years: 2023.
Data source: USPTO (United States Patent and Trademark Office) public patent records. Weekly synchronization. How IDiyas builds this profile
Company Filing History:
Years Active: 2023
Title: The Innovations of Stephen Navran: A Pioneer in Targeted Cardiac mRNA Technology
Introduction: Stephen Navran, an innovative inventor based in Houston, TX, has made significant contributions to the field of cardiology through his groundbreaking research and patented technology. His dedication to enhancing medical treatments is exemplified through his patented process of selectively expressing mRNAs in cardiomyocytes, providing new avenues for cardiac therapy.
Latest Patents: Navran holds one patent, which focuses on targeting technology to selectively express mRNAs in cardiomyocytes while avoiding the stimulation of cardiac fibroblasts. This patent discloses a process involving the selective adsorption and expression of mRNA in cardiomyocytes achieved by coupling an aptamer that specifically targets lipid nanoparticles containing mRNA to the cardiomyocytes while remaining inert towards fibroblasts. The administration of this aptamer coupled to the lipid nanoparticles is carried out under conditions favorable for mRNA expression in cardiomyocytes. A notable aspect of this invention is the preferred aptamer sequence identified as AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), with the mRNA encoded to express Stemin and/or YAP1(5SA).
Career Highlights: Stephen Navran is currently affiliated with Animatus Biosciences, LLC, where he continues to apply his expertise in the development of advanced therapeutic strategies for cardiac conditions. His contributions to the field of biotechnology display a noteworthy blend of scientific insight and innovative thinking.
Collaborations: Throughout his career, Navran has collaborated with various researchers and institutions to develop and refine his technological innovations, particularly in the area of targeted mRNA therapy for heart diseases. These partnerships are instrumental in pushing the boundaries of current medical practices and improving patient outcomes.
Conclusion: Stephen Navran exemplifies the spirit of innovation within the medical biotechnology field. His patent addressing the targeted expression of mRNAs in cardiomyocytes represents a significant step forward in cardiac treatment methodologies. With ongoing efforts at Animatus Biosciences, his work paves the way for future advancements that could greatly enhance therapeutic options in cardiology.
Data source: USPTO (United States Patent and Trademark Office) public patent records. Weekly synchronization. How IDiyas builds this profile