The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.
The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.
Patent No.:
Date of Patent:
Sep. 05, 2023
Filed:
Apr. 01, 2022
Animatus Biosciences, Inc., Houston, TX (US);
Stephen Navran, Houston, TX (US);
Animatus Biosciences, Inc., Houston, TX (US);
Abstract
Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).
Data source: USPTO (United States Patent and Trademark Office) public patent records. Weekly synchronization. How IDiyas builds this profile