Ashutosh Kumar Shukla

Title: Innovations of Ashutosh Kumar Shukla

Introduction

Ashutosh Kumar Shukla is a prominent inventor based in Lucknow, India. He has made significant contributions to the field of plant sciences, particularly in the identification and development of artemisinin-producing plants. His work has implications for both agriculture and medicine.

Latest Patents

Ashutosh Kumar Shukla holds 2 patents. His latest patents include a pair of primers for the identification of artemisinin-producing plants. The first patent describes a forward primer with the sequence CCAAGCTTGCTGAACGCATCGG and a reverse primer with the sequence CCAAGCTTGCCACGCAGGATTATC. This invention aids in the early identification of plants with high artemisinin content, facilitating the generation of plant populations with enhanced artemisinin levels. Another patent focuses on the selection and development of superior strains of plants to improve growth and health by inhibiting pathogenic fungi.

Career Highlights

Ashutosh Kumar Shukla is affiliated with the Council of Scientific & Industrial Research, where he conducts research and development in plant sciences. His innovative work has garnered attention in the scientific community and has contributed to advancements in agricultural practices.

Collaborations

He has collaborated with notable colleagues such as Suman Preet Singh Khanuja and Ajit Kumar Shasany, further enhancing the impact of his research through teamwork and shared expertise.

Conclusion

Ashutosh Kumar Shukla's contributions to the field of plant sciences through his patents and collaborations highlight his role as an influential inventor. His work not only advances scientific knowledge but also has practical applications in agriculture and medicine.