The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.
The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.
Patent No.:
Date of Patent:
Jan. 06, 2009
Filed:
Mar. 31, 2004
Suman Preet Singh Khanuja, Lucknow, IN;
Shilpi Paul, Lucknow, IN;
Ajit Kumar Shasany, Lucknow, IN;
Mahendra Pandurang Darokar, Lucknow, IN;
Ashutosh Kumar Shukla, Lucknow, IN;
Madan Mohan Gupta, Lucknow, IN;
Anuruddha Kumar, Lucknow, IN;
Suman Preet Singh Khanuja, Lucknow, IN;
Shilpi Paul, Lucknow, IN;
Ajit Kumar Shasany, Lucknow, IN;
Mahendra Pandurang Darokar, Lucknow, IN;
Ashutosh Kumar Shukla, Lucknow, IN;
Madan Mohan Gupta, Lucknow, IN;
Anuruddha Kumar, Lucknow, IN;
Council of Scientific & Industrial Research, New Delhi, IN;
Abstract
The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plantshaving high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.