Avon, CA, United States of America

Agnès Cibiel


Average Co-Inventor Count = 2.0

ph-index = 1


Company Filing History:


Years Active: 2015

Loading Chart...
1 patent (USPTO):Explore Patents

Title: Agnès Cibiel: Innovator in Nucleic Acid Research

Introduction

Agnès Cibiel is a notable inventor based in Avon, California. He has made significant contributions to the field of nucleic acid research, particularly in the development of specific ligands for annexin 2. His work has implications for various applications in biochemistry and molecular biology.

Latest Patents

Agnès Cibiel holds a patent for a specific ligand for annexin 2. The patent describes an aptamer that includes a nucleic acid sequence made up of GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCAGGACGC (SEQ ID NO: 1) or AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACCCGAUCGC (SEQ ID NO: 2). This invention is characterized by the condition that a nucleic acid made up of the specified sequences is bonded to annexin 2. He has 1 patent to his name.

Career Highlights

Agnès Cibiel is affiliated with the Commissariat à l'Énergie Atomique et aux Énergies Alternatives, where he continues to advance his research. His work has been instrumental in exploring the potential of aptamers in therapeutic applications.

Collaborations

Agnès collaborates with Frédéric Duconge, contributing to the innovative research environment at their institution.

Conclusion

Agnès Cibiel is a prominent figure in the field of nucleic acid research, with a focus on aptamers and their applications. His contributions continue to influence the scientific community and pave the way for future innovations.

This text is generated by artificial intelligence and may not be accurate.
Please report any incorrect information to support@idiyas.com
Loading…