The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.
The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.
Patent No.:
Date of Patent:
Jan. 27, 2015
Filed:
Nov. 10, 2011
Frédéric Duconge, Sceaux, FR;
Agnès Cibiel, Avon, CA (US);
Frédéric Duconge, Sceaux, FR;
Agnès Cibiel, Avon, CA (US);
Abstract
The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.
Data source: USPTO (United States Patent and Trademark Office) public patent records. Weekly synchronization. How IDiyas builds this profile