The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.
The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.
Patent No.:
Date of Patent:
Jan. 27, 2015
Filed:
Nov. 10, 2011
Applicants:
Frédéric Duconge, Sceaux, FR;
Agnès Cibiel, Avon, CA (US);
Inventors:
Frédéric Duconge, Sceaux, FR;
Agnès Cibiel, Avon, CA (US);
Assignee:
Attorney:
Primary Examiner:
Int. Cl.
CPC ...
C07H 21/04 (2006.01); C07H 21/02 (2006.01); C12N 15/115 (2010.01);
U.S. Cl.
CPC ...
C07H 21/02 (2013.01); C12N 15/115 (2013.01); C12N 2310/16 (2013.01); C12N 2310/344 (2013.01); C12N 2310/351 (2013.01); C12N 2310/3517 (2013.01);
Abstract
The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.