Title: Petra Vychytilova: Innovator in Colorectal Cancer Diagnosis
Introduction
Petra Vychytilova is a notable inventor based in Brno, Czech Republic. She has made significant contributions to the field of medical diagnostics, particularly in the area of colorectal cancer. Although she currently holds no granted patents, her innovative work is reflected in her patent application.
Latest Patent Applications
Petra Vychytilova's latest patent application is titled "Method of Diagnosis of Colorectal Cancer." This method utilizes piRNA-hsa-5937, with the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker. The method is designed to diagnose and prognose colorectal cancer in a non-invasive manner, using a body fluid as the input. It boasts high sensitivity and specificity, even in the early stages of the disease, and is cost-effective.
Conclusion
Petra Vychytilova's work in developing innovative diagnostic methods for colorectal cancer showcases her dedication to advancing medical science. Her contributions, although not yet reflected in granted patents, hold promise for future advancements in cancer diagnosis.