Brno, Czechia

Milana Sachlova

 


Loading Chart...

Title: Milana Sachlova - Innovator in Colorectal Cancer Diagnosis

Introduction

Milana Sachlova is an accomplished inventor based in Brno, Czech Republic. She has made significant contributions to the field of medical diagnostics, particularly in the area of colorectal cancer. Although she currently holds no granted patents, her innovative work is noteworthy.

Latest Patent Applications

Milana Sachlova's latest patent application is titled "Method of Diagnosis of Colorectal Cancer." This method utilizes piRNA-hsa-5937, with the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker. The application highlights the use of a body fluid as the input, making the method non-invasive. It boasts high sensitivity and specificity, even in the early stages of the disease, and is designed to be cost-effective.

Conclusion

Milana Sachlova's work in developing a non-invasive method for diagnosing colorectal cancer showcases her dedication to advancing medical technology. Her innovative approach has the potential to significantly impact patient care and early detection of this disease.

This text is generated by artificial intelligence and may not be accurate.
Loading…