The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.

The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.

Date of Patent:
Sep. 08, 2015

Filed:

Oct. 10, 2011
Applicants:

Vittorio DE Franciscis, Naples, IT;

Laura Cerchia, Naples, IT;

Inventors:

Vittorio De Franciscis, Naples, IT;

Laura Cerchia, Naples, IT;

Attorney:
Primary Examiner:
Int. Cl.
CPC ...
C07H 21/04 (2006.01); C12N 15/11 (2006.01); A61K 31/7088 (2006.01); C12N 15/115 (2010.01); A61K 39/395 (2006.01); A61K 45/00 (2006.01);
U.S. Cl.
CPC ...
A61K 31/7088 (2013.01); A61K 39/395 (2013.01); A61K 45/00 (2013.01); C12N 15/115 (2013.01); C12N 2310/16 (2013.01); C12N 2310/322 (2013.01); C12N 2310/344 (2013.01);
Abstract

The present invention concerns a nucleotide aptamer having the sequence 5' GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3′ (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.


Find Patent Forward Citations

Loading…