The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.
The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.
Patent No.:
Date of Patent:
Jun. 12, 2012
Filed:
Aug. 12, 2008
Jorg Vollmer, Dusseldorf, DE;
Eugen Uhlmann, Glashuetten, DE;
Arthur M. Krieg, Wellesley, MA (US);
Douglas C. Hanson, Niantic, CT (US);
Ulrike Samulowitz, Langenfeld, DE;
Jorg Vollmer, Dusseldorf, DE;
Eugen Uhlmann, Glashuetten, DE;
Arthur M. Krieg, Wellesley, MA (US);
Douglas C. Hanson, Niantic, CT (US);
Ulrike Samulowitz, Langenfeld, DE;
Coley Pharmaceutical GmbH, Düsseldorf, DE;
Coley Pharmaceutical Group, Inc., Wellesley, MA (US);
Pfizer Inc, New York, NY (US);
Abstract
Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5' TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.