The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.

The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.

Date of Patent:
May. 31, 2005

Filed:

Feb. 22, 2002
Applicants:

Martin Gleave, Vancouver, CA;

Paul S. Rennie, Richmond, CA;

Hideaki Miyake, Vancouver, CA;

Colleen Nelson, Surrey, CA;

Brett P. Monia, Encinitas, CA (US);

Inventors:

Martin Gleave, Vancouver, CA;

Paul S. Rennie, Richmond, CA;

Hideaki Miyake, Vancouver, CA;

Colleen Nelson, Surrey, CA;

Brett P. Monia, Encinitas, CA (US);

Assignee:
Attorney:
Primary Examiner:
Assistant Examiner:
Int. Cl.
CPC ...
A61K031/70 ;
U.S. Cl.
CPC ...
Abstract

A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2'-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.


Find Patent Forward Citations

Loading…