The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.
The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.
Patent No.:
Date of Patent:
Jan. 30, 2001
Filed:
Feb. 26, 1999
Counsel of Scientific & Industrial Research, New Delhi, IN;
Abstract
An improved process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons obtained by amplifying sequences of synthetic oligonucleotide primers identified as SEQ ID NOS:4 to 7 (5′GGATCCCTATlAGTG 3′; 5′GGATCCCITTTGCACTC 3′; 5CGAAATCGGTAGACGATACG3′ and 5′GGGGATAGAGGGACTTGAAC 3′) useful for sex determination, said process comprising isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double stranded amplified product from the gel piece by known methods, cloning the said product in a known vector by conventional methods, sequencing the said cloned product by known methods, synthesizing the single stranded chains of synthetic oligonucleotides by known method based on the said sequence data, amplifying the said nucleic acid in a Conventional Sequence Tagged Site Polymerase Chain Reaction by using synthetic oligonucleotides as primers to get sex specific and gender-neutral semisynthetic amplicons simultaneously.