The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.

The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.

Date of Patent:
Nov. 05, 1996

Filed:

Apr. 14, 1994
Applicant:
Inventors:

Sadayori Hoshina, Tokyo, JP;

I Bernard Weinstein, Englewood, NJ (US);

Attorney:
Primary Examiner:
Int. Cl.
CPC ...
C12P / ; C12Q / ;
U.S. Cl.
CPC ...
435-6 ; 435 912 ; 935 77 ; 935 78 ;
Abstract

This invention provides a DNA oligomer having the sequence 5'GGACATAGGCTGATCTCTTAGC3' (SEQ ID NO: 1) and which is complementary to Campylobacter pylori 16S ribosomal RNA sequences, for use as a probe to detect Campylobacter pylori. This invention also provides DNA oligomers having the sequences 5'GCGCAATCAGCGTCAGGTAATG3' (SEQ ID NO: 2) and 5'GCTAAGAGATCAGCCTATGTCCC3' (SEQ ID NO: 3) and which are complementary to certain Campylobacter pylori 16S ribosomal RNA sequences, for use as polymerase chain reaction primers for the detection of Campylobacter pylori. This invention also provides a method for producing species-specific bacterial or protozoan DNA oligomers encoding 16S ribosomal RNA by means of the polymerase chain reaction for use as species-specific probes and PCR primers, and methods for detection and identification of bacteria and protozoa. Further, this invention provides a DNA oligomer having the sequence 5'ACGGGCGGTGTGTGC3' (SEQ ID NO: 4).


Find Patent Forward Citations

Loading…