The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.

The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.

Date of Patent:
Apr. 02, 2024

Filed:

Mar. 05, 2019
Applicant:

Stellenbosch University, Stellenbosch, ZA;

Inventors:

Anna-Maria Botha-Oberholster, Stellenbosch, ZA;

Hendrik Willem Swiegers, Stellenbosch, ZA;

Nicolaas Francois Visser Burger, Somerset West, ZA;

Assignee:

Stellenbosch University, Stellenbosch, ZA;

Attorneys:
Primary Examiner:
Assistant Examiner:
Int. Cl.
CPC ...
A01N 63/60 (2020.01); C12N 15/113 (2010.01);
U.S. Cl.
CPC ...
A01N 63/60 (2020.01); C12N 15/113 (2013.01);
Abstract

The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA ofcprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog ofcprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5′ UAAACAAUCGCAAGAAGCUGA 3′ (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5′ AGCUUCUUGCGAUUGUUUAAG 3′ (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.


Find Patent Forward Citations

Loading…