logo

For the Inventor, By the Inventor

The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.

The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.

Patent No.:

US 11096955 B1

PDFFull Text
Expired
Date of Patent:
Aug. 24, 2021

Filed:

Feb. 09, 2017

Synthetic promoters and uses thereof

Applicant:

Fondazione Telethon, Rome, IT;

Inventors:

Enrico Maria Surace, Rome, IT;

Mariangela Lupo, Rome, IT;

Salvatore Botta, Rome, IT;

Elena Marrocco, Rome, IT;

Nicola De Prisco, Rome, IT;

Assignee:

Fondazione Telethon, Rome, IT;

Attorney:

Lucas & Mercanti, LLP

Primary Examiner:

Amy H Bowman

Int. Cl.
CPC ...
C07H 21/02 (2006.01); A61K 48/00 (2006.01); A61K 31/7105 (2006.01); C07K 14/72 (2006.01); C12N 15/113 (2010.01); A61P 27/00 (2006.01); C12N 15/67 (2006.01); C12N 15/85 (2006.01); C12N 15/62 (2006.01); C07K 14/00 (2006.01);
U.S. Cl.
CPC ...
A61K 31/7105 (2013.01); A61P 27/00 (2018.01); C07K 14/00 (2013.01); C07K 14/72 (2013.01); C12N 15/113 (2013.01); C12N 15/625 (2013.01); C12N 15/67 (2013.01); C12N 15/8509 (2013.01); C12N 2830/008 (2013.01);
Abstract

The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.

Find Patent Forward Citations

Surace, Enrico. (2021). Synthetic promoters and uses thereof (U.S. Patent No. 11096955). U.S. Patent and Trademark Office. https://idiyas.com/patent/badge/11096955

Data source: USPTO (United States Patent and Trademark Office) public patent records. Weekly synchronization. How IDiyas builds this profile

Loading…