The patent badge is an abbreviated version of the USPTO patent document. The patent badge does contain a link to the full patent document.

The patent badge is an abbreviated version of the USPTO patent document. The patent badge covers the following: Patent number, Date patent was issued, Date patent was filed, Title of the patent, Applicant, Inventor, Assignee, Attorney firm, Primary examiner, Assistant examiner, CPCs, and Abstract. The patent badge does contain a link to the full patent document (in Adobe Acrobat format, aka pdf). To download or print any patent click here.

Date of Patent:
Nov. 13, 2018

Filed:

May. 21, 2013
Applicant:

Olix Pharmaceuticals, Inc., Seoul, KR;

Inventor:

Sun Woo Hong, Suwon-si, KR;

Assignee:
Attorney:
Primary Examiner:
Int. Cl.
CPC ...
C12N 15/11 (2006.01); C12N 15/113 (2010.01); C12N 15/87 (2006.01);
U.S. Cl.
CPC ...
C12N 15/113 (2013.01); C12N 15/111 (2013.01); C12N 15/87 (2013.01); C12N 2310/14 (2013.01); C12N 2310/313 (2013.01); C12N 2310/315 (2013.01); C12N 2310/3515 (2013.01); C12N 2320/32 (2013.01);
Abstract

Provided herein are RNAi-inducing double-stranded nucleic acid molecules having cell penetrating ability and targeting mRNA encoding a connective tissue growth factor (CTGF). In certain embodiments, the RNAi-inducing double-stranded nucleic acid molecule comprises a first strand of having a sequence of UCUUCCAGUCGGUAAGCCGCGAGGGCAGGCC and comprising 4 to 17 phosphorothioate bonds and at least one 2'-O-Me modified nucleotide, as well as a second strand having a sequence of CUUACCGACUGGAAGA and comprising at least one phosphorothioate bond and at least one 2′-O-Me modified nucleotide and further comprising a cholesterol moiety covalently attached to its 3′ end.


Find Patent Forward Citations

Loading…