Consiglio Nazionale Delle Ricerche

Bracco Imaging S.p.a.

The University of Texas System

Consiglio Nazionale Delle Richerche

Commissariat a L'energie Atomique Et Aux Energies Alternatives

Vittorio De Franciscis

Laura Cerchia

Alessandro Maiocchi

Luisa Poggi

Erika Reitano

Carla Lucia Esposito

Gerolama Condorelli

Margherita Iaboni

Silvia Catuogno

Gabriel Lopez-Berestein

David L Volk

Anil K Sood

Bertrand Tavitian

Frédéric Duconge

Paola Amero

Cristian Rodriguez-aguayo

Rahul Mitra

Lokesh Ganesh L Rao

Silvia Nuzzo

Aldo Di Vito

Domenico Libri

The present invention provides nucleic acid aptamers binding to the Carbonic Anhydrase IX (CA-IX) enzyme, derivatives and conjugates thereof and their use as diagnostic tools, particularly for the imaging of organs and tissues expressing CA-IX, or as therapeutic agents for prevention or treatment of CA-IX related diseases.

CA-IX aptamers and diagnostic and therapeutic uses thereof

Provided herein are DNA aptamers targeting AXL receptor kinase. The DNA aptamers may comprise a thiophosphate backbone and be chemically modified. Further provided herein are methods of use thereof for the treatment of a disease or disorder, such as cancer.

DNA aptamers and use thereof for the treatment of cancer

The present invention provides nucleic acid aptamers binding to the Intercellular Adhesion Molecule-1 (ICAM-1), derivatives and conjugates thereof and their use as diagnostic tools, particularly for the imaging of organs and tissues expressing ICAM-1, or as therapeutic agents for prevention or treatment of ICAM-1-related diseases.

ICAM-1 aptamers, diagnostic and therapeutic uses thereof

Nuclease-resistant RNA aptamers are provided which are capable of neutralizing PDGFR&#x3b2; and are therefore useful in the diagnosis and/or therapy of PDGFR&#x3b2;-associated and hyperproliferative-associated diseases, such as cancer and primary tumor metastasis. RNA aptamers provided herein include a modified synthetic RNA sequence wherein at least one pyrimidine residue is modified to 2'-fluoropyrimidine. Pharmaceutical compositions and diagnostic kits comprising RNA aptamers are also provided.

Neutralizing RNA aptamers

The present invention concerns a nucleotide aptamer having the sequence 5' GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3&#x2032; (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.

EGFR aptamer inhibitor for use in therapy and diagnosis

The present invention concerns a nucleotide aptamer having the sequence: 5'-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3&#x2032;(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.

Axl receptor tyrosine kinase aptamer inhibitor for use in therapy

The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes.

Method for obtaining oligonucleotide aptamers and uses thereof

Growing community of inventors

Naples, Italy

Vittorio De Franciscis