Council of Scientific and Industrial Research

Vidya Shrikant Gupta

Ashok Prabhakar Giri

Ashish Balwant Deshpande

Prabhakar K Ranjekar

Hemangi Girish Chidley

Ram Shridhar Kulkarni

Keshav H Pujari

Anjali S Parasnis

Vaijayanti Abhijit Tamhane

Pranjali Sudhir Oak

Rakesh Shamsunder Joshi

Manasi Mishra

Rajendra Ramchandra Joshi

Uddhavesh Bhaskar Sonavane

Anirban Ghosh

Sagar Subhash Pandit

The present invention provides a polynucleotide having the nucleotide sequence as set forth in SEQ ID NO: 1 encoding 9-lipoxygenase. The present invention also provides recombinant plasmid expression vector comprising said polynucleotide. The recombinant protein 9-lipoxygenase encoded by the polynucleotide leads to production of lactones in fruits such as mangoes.

Nucleotide sequence encoding 9-lipoxygenase and recombinant constructs comprising the same

The present invention provides the polynucleotide encoding enzyme involved in lactone synthesis and a process for synthesis of lactones using said polynucleotides. The invention also provides recombinant plasmid expression vector comprising said polynucleotide sequence. The recombinant protein encoded by said polynucleotides leads to synthesis of lactones having flavour peculiar to Alphonso mangoes.

Recombinant polynucleotide involved in lactone synthesis and process for synthesis of lactones thereof

The present invention relates to the cloning and expression of cDNA encoding O-methyl transferase for catalyzing the synthesis of vital volatile flavor compounds such as mesifuran and vanillin, thereby playing a significant role in flavor biochemistry of mango. The present invention also provide a process for the preparation of volatile compounds by mesifuran, ferulic acid, guaiacol and vanillin, specifically mesifuran and vanillin using cDNA sequence.

Molecular cloning and expression of cDNA encoding O-methyltransferase isolated from

Disclosed herein are primers for amplifying enone oxidoreductase, having a sequence selected from the group consisting of SEQ ID Nos. 1 to 13, from mango. Also disclosed herein is a nucleotide sequence of SEQ ID No. 14 encoding enone oxidoreductase, for enzyme production in an artificial system thus generating the desired flavor in food products.

CDNA encoding enone oxidoreductase from mango

The present invention discloses primers for amplifying farnesyl pyrophosphate synthase gene, having sequence selected from the group consisting of Seq Id. nos. 1-3 and 5-7, from mango. Also disclosed herein is a novel nucleotide sequence of sequence ID no. 8 encoding said amplified farnesyl pyrophosphate synthase (FPPS) for enzyme production in an artificial system thus generating the desired flavor in food products.

Primer for amplifying farnesyl pyrophosphate synthase from mango

The present invention relates to a method for pest management using inhibitory repeat domain IRD 9 (Seq ID No.2) proteinase inhibitor showing enhanced inhibitory activity against the gut proteases of insects. More particularly, the present invention relates to a IRD 9 (Seq ID No.2) proteinase inhibitor from non-host plant, which possesses significantly high insect protease inhibition activity against the gut proteases of

Method for effective management of helicoverpa armigera

An improved process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons obtained by amplifying sequences of synthetic oligonucleotide primers identified as SEQ ID NOS:4 to 7 (5&prime;GGATCCCTATlAGTG 3&prime;; 5&prime;GGATCCCITTTGCACTC 3&prime;; 5CGAAATCGGTAGACGATACG3&prime; and 5&prime;GGGGATAGAGGGACTTGAAC 3&prime;) useful for sex determination, said process comprising isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double stranded amplified product from the gel piece by known methods, cloning the said product in a known vector by conventional methods, sequencing the said cloned product by known methods, synthesizing the single stranded chains of synthetic oligonucleotides by known method based on the said sequence data, amplifying the said nucleic acid in a Conventional Sequence Tagged Site Polymerase Chain Reaction by using synthetic oligonucleotides as primers to get sex specific and gender-neutral semisynthetic amplicons simultaneously.

Process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination

The present invention features an 831-base pair DNA fragment, and a method for the preparation of semisynthetic amplicon which is useful for determining the sex of a papaya plant.

Growing community of inventors

Pune, India

Vidya Shrikant Gupta