Coley Pharmaceutical Group, Inc.

Coley Pharmaceutical Gmbh

Pfizer Corporation

Adiutide Pharmaceuticals Gmbh

Rechtsanwalt Thomas Beck

Ulrike Samulowitz

Eugen Uhlmann

Arthur Mertz Krieg

Jörg Vollmer

Grayson B Lipford

Marion Jurk

Robert Rankin

Douglas Charles Hanson

Grayson Lipford

Bernhard O Noll

Joerg Vollmer

Bernhard Noll

The invention relates to a class of soft or semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response.

Immunostimulatory nucleic acids

Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5' TCGTCGTTTTCGGCGCGCGCCGT 3&#x2032; (SEQ ID NO: 1), in which each C is unmethylated and 3&#x2032; refers to the 3&#x2032; end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-&#x3b3;. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Combination motif immune stimulatory oligonucleotides with improved activity

The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.

Semi-soft c-class immunostimulatory oligonucleotides

Semi-soft C-class immunostimulatory oligonucleotides

Growing community of inventors

Langenfeld, Germany

Ulrike Samulowitz