The Green Cross Corporation

Yoshitomi Pharmaceutical Industries, Ltd.

Mitsubishi Pharma Corporation

Takao Ohmura

Akinori Sumi

Wataru Ohtani

Kazumasa Yokoyama

Munehiro Noda

Kaoru Kobayashi

Shinobu Kuwae

Satoshi Funakoshi

Yutaka Hirao

Kaeko Kamide

Tomoshi Ohya

Naoto Furuhata

Kazuya Takeshima

Yahiro Uemura

Toyoo Ohda

Kenji Tomomitsu

Akimasa Ohmizu

Syoichi Ishikawa

Masahide Kondo

Naoto Fuluhata

Kazuhiro Oohara

Tadakazu Suyama

Kazuo Takechi

Hiroshi Morise

Masami Miura

Ryuji Hiramatsu

Hideyuki Ohi

Nagatoshi Fujiwara

Hirotoshi Fukutsuka

Kenji Tanaka

Yasuo Ueda

Hirofumi Arimura

Masayuki Nishida

Motonori Hashimoto

Haruhide Kawabe

Tsunetaka Nakajima

Yoshio Kagitani

Kenmi Miyano

Yusei Shiraga

Shusei Uno

Ken Okabayashi

Masako Chuganji

Shoju Kameyama

Tunetaka Nakajima

Takuji Doi

Takuji Hanamura

Tomoshi Ooya

Terufumi Fujiwara

Yoshitaka Sakanishi

The invention provides a process for purifying recombinant human serum albumin (rHSA) by heating a-culture medium containing rHSA and the rHSA-producing host cells, feeding said heated solution upwardly into a fluidized bed in which adsorbent particles are suspended to effect contacting with the adsorbent particles and then recovering the adsorbed fraction containing the rHSA, and a composition comprising rHSA which shows a A350/A280 ratio of below 0.015, when formulated into a 25% solution of said albumin.

Process for purifying recombinant human serum albumin

Method for producing protein

Human serum albumin obtained by gene manipulation techniques can be purified by a combination of specified steps in which a culture supernatant obtained from a human serum albumin-producing host is subjected to ultrafiltration, heat treatment, acid treatment and another ultrafiltration, followed by subsequent treatments with a cation exchanger, a hydrophobic chromatography carrier and an anion exchanger, and by salting-out to thereby obtain a pure form of human serum albumin which contains substantially no proteinous and polysaccharide contaminants, which is formulated into a pharmaceutical preparation. The thus obtained human serum albumin can further be purified by treating recombinant human serum albumin with a hydrophobic chromatography carrier at pH of 2 to 5 and a salt concentration of 0.4 to 1 and exposing the carrier to a pH of 6 to 8 and a salt concentration of 0.01 to 0.3 M, or treating the culture supernatant with boric acid or a salt thereof at pH 8 to 11 for 1 to 10 hours and recovering the supernatant. This process makes it possible to effeciently purify recombinant human serum albumin and to provide substantially pure human serum albumin which does not contain producer host-related substances and other contaminants and is sufficiently free from coloration.

Recombinant human serum albumin, process for producing the same and

The invention provides a process for purifying recombinant human serum albumin (rHSA) by heating a culture medium containing rHSA and the rHSA-producing host cello, feeding said heated solution upwardly into a fluidized bed in which adsorbent particles are suspended to effect contacting with the adsorbent particles and then recovering the adsorbed fraction containing the rHSA, and a composition comprising rHSA which shows a A35D/A280 ratio of below 0.015, when formulated into a 25% solution of said albumin.

A method for decoloring a recombinant human serum albumin by treating the albumin with a reducing agent is disclosed. Also, a method for decoloring a recombinant human serum albumin by treating the albumin with a method removing free polysaccharides with a cation exchanger followed by heat treatment is disclosed. The present invention provides a recombinant human serum albumin, coloring of which is fully suppressed by preventing binding of certain coloring components, which are contained in the raw materials or contaminants secreted by a microorganism, to human serum albumin so as not to cause coloring of the human serum albumin.

Method for decoloring human serum albumin

A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Mutant AOX2 promoter, vector carrying same, transformant and production

A recombinant human serum albumin (rHSA) pharmaceutical preparation is sterilized by subjecting a pharmaceutical preparation of rHSA obtained by gene manipulation techniques packed in a container in an administration unit to heat treatment at 50.degree. to 80.degree. C. for 30 minutes or more. By the disclosed method, rHSA having high safety can be provided since microorganisms contaminated in rHSA pharmaceutical preparations die as a result of the sterilization method of the present invention.

Method for sterilizing recombinant human serum albumin pharmaceutical

A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 is deleted, (2) nucleotide(s) is(are) replaced in region(s) in nucleotides 1274-1314, and (3) new oligonucleotide(s) is (are) inserted in region(s) in nucleotides 1274-1314, a vector carrying said mutant AOX2 promoter, a transformant into which said vector has been introduced, and a method for producing a heterologous protein, which comprises cultivating said transformant. The promoter of the present invention has remarkably enhanced activity as compared with natural AOX2 promoter, and is highly useful as a promoter to be carried in an expression vector allowing heterologous protein expression. In addition, the vector and the transformant of the invention can efficiently express and produce various useful heterologous proteins.

Mutant AOX2 promoter, vector carrying same, transformant, and production

Method for highly purifying human serum albumin

A methylotrophic and glucotrophic mutant strain capable of producing a heterologous protein and a method for producing a heterologous protein, comprising culture of the mutant strain. The mutant strain of the present invention can be grown in a medium containing both methanol and glucose, with the effect that the growth of the strain and production of a heterologous protein proceed at the same time. Accordingly, a heterologous protein can be produced in a large amount in a short time.

Mutant strain of Pichia pastoris which utilizes methanol in the presence

A process for producing recombinant human serum albumin is disclosed, which comprises culturing a human serum albumin-producing host, prepared by gene manipulation techniques in a medium that contains an amino acid, preferably at least one amino acid selected from the group consisting of alanine, aspartic acid, glutamic acid, histidine, serine, tryptophan, valine, isoleucine, phenylalanine, cysteine and arginine, more preferably histidine. The process can significantly increase the yield of human serum albumin over that produced by known processes.

Process for producing recombinant human serum albumin

Human serum albumin obtained by gene manipulation techniques can be purified by a combination of specified steps in which a culture supernatant obtained from a human serum albumin-producing host is subjected to ultrafiltration, heat treatment, acid treatment and another ultrafiltration, followed by subsequent treatments with a cation exchanger, a hydrophobic chromatography carrier and an anion exchanger, and by salting-out to thereby obtain a pure form of human serum albumin which contains substantially no proteinous and polysaccharide contaminants, which is formulated into a pharmaceutical preparation. This process makes it possible to effeciently purify recombinant human serum albumin and to provide substantially pure human serum albumin which does not contain producer host-related substances and other contaminants and is sufficiently free from coloration.

A method for suppressing coloring of human serum albumin expressed by genetic engineering, which comprises culture and/or purification in the presence of an amine compound selected from the group consisting of alkylamines, diamines, guanidines, benzamidines, basic amino acids, and aminophenylacetic acids. According to the present invention, coloring of HSA expressed by genetic engineering can be suppressed to from one-half to one-tenth of that without treatment for coloring suppression. In addition, HSA can be recovered in high yields, and the treatment of the invention does not affect the inherent properties of HSA.

Method for suppressing coloring of human serum albumin

A method for producing human serum albumin which comprises cultivating a human serum albumin-producing host prepared by genetic engineering, in a medium containing a fatty acid having 10 to 26 carbon atoms, or its salt, and a method for cultivating the host. HSA production can be greatly increased by the present invention.

Fatty acid supplemented medium for recombinant production of human serum

Growing community of inventors

Osaka, Japan

Takao Ohmura