Olix Pharmaceuticals, Inc.

Sun Woo Hong

Dong Ki Lee

Ji Hyun Kim

Isu Hong

Hanna Lee

Jihye Hwang

Ji Eom

Tae Yeon Lee

Dayeon Yu

Dong-Ki Lee

Sae-Lo-Oom Lee

Yu Ran Na

Young-Dong Kim

Sae Lo Oom Lee

Ji Hye Hwang

The present invention relates to an asymmetric siRNA which inhibits an expression of male pattern hair loss target genes and a use thereof and, more particularly, to an asymmetric siRNA which inhibits an expression of 3-oxo-5-alpha-steroid-4-dehydrogenase 1 (SRD5A1) gene, 3-oxo-5-alpha-steroid-4-dehydrogenase 2 (SRD5A2) gene or androgen receptor (AR) gene, and a composition for prevention or treatment of hair loss comprising the asymmetric siRNA.

Asymmetric siRNA for inhibiting expression of male pattern hair loss target gene

In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs or cell penetrating asiRNAs) that inhibit IL4R&#x3b1;, TRPA1, and/or F2RL1 expression and are therefore useful for treating atopic dermatitis or asthma.

Treatment of atopic dermatitis and asthma using RNA complexes that target IL4R&#x3b1;, TRPA1, or F2RL1

The present invention relates to a novel, RNAi-inducing nucleic acid molecule having cell penetrating ability and the use thereof, and more particularly, to a novel, RNAi-inducing double-stranded nucleic acid molecule, which has a replacement of the phosphate backbone of at least one nucleotide with phosphorothioate or phosphorodithioate, and has a lipophilic compound conjugated thereto, and thus has high target gene-silencing efficiency while having the ability to penetrate cells without needing a separate intracellular delivery vehicle, and to a method of silencing a target gene using the nucleic acid molecule. The nucleic acid structure according to the present invention has both cholesterol modification and phosphorothioate modification introduced therein, and thus has high gene silencing efficiency while having the ability to penetrate cells without needing a separate intracellular delivery vehicle. Thus, it can be delivered into an actual target area in an amount sufficient for induction of RNAi, and thus can overcome the in vivo delivery problem occurring in the prior art. Therefore, the nucleic acid molecule according to the invention can effectively substitute for conventional siRNA molecules to treat cancer or viral infections.

RNA-interference-inducing nucleic acid molecule able to penetrate into cells, and use therefor

In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs or cell penetrating asiRNAs) that inhibit CTGF expression and are therefore useful for treating idiopathic pulmonary fibrosis.

Treatment of idiopathic pulmonary fibrosis using RNA complexes that target connective tissue growth factor

In certain aspects, provided herein are RNA complexes that inhibit Myeloid differentiation primary response gene 88 (MyD88) and/or Toll-like receptor 3 (TLR3) and are useful in the treatment of age-related macular degeneration (AMD). In certain aspects, provided herein are pharmaceutical compositions comprising such RNA complexes and methods of using such RNA complexes and pharmaceutical compositions.

Treatment of age-related macular degeneration using RNA complexes that target MyD88 or TLR3

In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs or cell penetrating asiRNAs) that inhibit ANGPT2 and/or PDGFB expression and are therefore useful for treating angiogenesis-associated diseases, such as cancer, AMD, and DME.

Treatment of angiogenesis-associated diseases using RNA complexes that target ANGPT2 and PDGFB

In certain aspects, provided herein are RNA complexes (e.g., asymmetric RNA complexes, such as asiRNAs and lasiRNAs) that inhibit tyrosinase expression and are therefore useful for reducing melanin production and for treating pigmentation-related disorders associated with excessive melanin production, such as melasma and age spots.

RNA complexes that inhibit melanin production

Provided herein are RNAi-inducing double-stranded nucleic acid molecules having cell penetrating ability and targeting mRNA encoding a connective tissue growth factor (CTGF). In certain embodiments, the RNAi-inducing double-stranded nucleic acid molecule comprises a first strand of having a sequence of UCUUCCAGUCGGUAAGCCGCGAGGGCAGGCC and comprising 4 to 17 phosphorothioate bonds and at least one 2'-O-Me modified nucleotide, as well as a second strand having a sequence of CUUACCGACUGGAAGA and comprising at least one phosphorothioate bond and at least one 2&#x2032;-O-Me modified nucleotide and further comprising a cholesterol moiety covalently attached to its 3&#x2032; end.

Growing community of inventors

Seoul, South Korea

Sun Woo Hong