Council of Scientific and Industrial Research

Other

Department of Biotechnology

Suman Preet Singh Khanuja

Sushil Kumar

Ajit Kumar Shasany

Mahendra Pandurang Darokar

Madan Mohan Gupta

Tiruppadiripuliyur Ranganathan Santha Kumar

Nirmal Kumar Patra

Alok Kalra

Dharmendra Saikia

Janak Raj Bahl

Anil Kumar Singh

Raj Kishori Lal

Sunita Dhawan

Hemendra Pratap Singh

Vivek Kumar Gupta

Vijay Pal Singh

Suchi Srivastava

Ravi Prakash Bansal

Hasan Tanveer

Anil Kumar Gupta

Nareshwar Mengi

Ved Ram Singh

Ram Kishor Verma

Monika Singh

Jai Shankar Arya

Birendra Kumar

Santosh Kumar Srivastava

Ajit Kumar Shasney

Vijay Kumar

Atul Prakash Kahol

Ali Arif Naqvi

Paltoo Ram

Krishna Kumar Agarwal

Dharmendra Kumar Rajput

Prachi Sinha

Subhash Chandra Gupta

Dharam Chand Jain

Om Parkash Dhawan

Harikesh Bahadur Singh

Hari Om Misra

Raja Ram

Mansoor Alam

Arun Kumar Tripathy

Soumya Awasthi

Arif Ali Naqvi

Merajuddin Khan

Anirban Pal

Ankur Garg

Rajendra Singh Bhakuni

Sudeep Tandon

Tarun Kumar Singh

Sunil Balkrishna Mansinghka

Suresh Haribhau Dawle

Arvind Singh Negi

Jawahar Ram Sharma

Sarita Satapathy

Mahendra Singh Negi

Abdul Sattar

Jitendra Pal Singh

Herikesh Bahadur Singh

Kambod Singh

Samresh Dwivedi

Neeraj Kumar Tyagi

Gopal Rao Mallavarapu

Sweta Agarwal

Abdul Samad

Shiv Ram Sharma

Mohammad Zaim

Ram Kishore Verma

Aparbal Singh

Sunil Kumar Chattopadhyay

Shiv Kumar Gupta

Sachin Srivastava

Suchitra Banerjee

Alok Krishna

Anil Srivastava

Yogendra Nath Shukla

Dharani Dhar Patra

Ram Sajeevan Shukla

Ateeque Ahmed

Subhash Chandra Singh

Virendra Kumar Singh Tomar

Digvijay Singh

Guru Das Bagchi

Asish Kumar Bhattacharya

Satyawan Singh

Anil Kumar Dwivedi

Man Mohan Singh

Anand Pal Singh

Veena Prajapati

Surendra Pratap Singh

Chandeshwar Nath

Srikant Sharma

Amit Tewari

Arun Kumar Kukreja

Guru Prakash Dutta

Arun Kumar Tripathi

Ajay Pratap Singh

Neetu Katiyar

Rakesh Pandey

The present invention relates to bioactive extracts its fractions and isolation of compound from. The extracts and fractions are useful for the treatment of psychosis based on in-vivo validation on animal model and proportional binding affinities for dopaminergic-D, Cholinergic (muscarinic) and Serotonergic (5HT) receptors for antipsychotic activity. The present invention relates to novel antipsychotic activity in the leaf alkaloids of Formula 1 and 2 named tetrahydroalstonine, 10-methoxytetrahydroalstonine, isoreserpiline, 10-demethoxyreserpiline, 11-demethoxyreserpiline, reserpiline and &#x3b1;-yohimbine. The present invention also relates to processes for obtaining antipsychotic extracts as well as for the isolation of alkaloids of formula 1 and 2 from the leaves of. The present invention particularly relates to significant antipsychotic activity in the MeOH extract, ethylacetate and chloroform fractions ofand in the isolated compounds &#x3b1;-yohimbine, reserpiline and in a mixture 10-demethoxyreserpiline and 11-demethoxyreserpiline in 1:1.5 ratios for treating psychosis without any extra pyramidal symptoms (EPS). 

[object Object]

The present invention provides novel loganin analogues and a process for the preparation thereof. The present invention further provides the use of Iridoid glycoside loganin isolated from the fruit pulp of-and its bioactive semi-synthetic analogues against various human cancer cell lines grown in-vitro.

Loganin analogues and a process for the preparation thereof

The present invention provides a process for production of an anticancer taxoid brevifoliol of the formula I from plants belonging to the genusby first extracting the dried and pulverized leaves of the plant with an alcohol preferably at a temperature in the range of 20-40&#xb0; C. and then. concentrating the solvent to obtain an alcoholic extract. The alcoholic extract obtained is then adsorbed with an adsorbent and the resulting adsorbed material is then dried at a temperature ranging from 20-50&#xb0; C. for 4-48 hours. The dried adsorbed material is then extracted with a combination of an aliphatic solvent and a chlorinated solvent successively and concentrated to obtain a residue. The residue is subjected to gross fractionation using column chromatography such as silica gel, florosil and silicic acid followed by chromatography with a suitable adsorbent to get brevifoliol.

Process for preparing brevifoliol

A new and distinct somaclone of rose scentedchristened 'Parimal' characterized by distinct morphology and improved oil yield determining parameters.

New and distinct somaclonal variety of rose scented geranium

The invention provides a simple method for isolation of calliterpenone (16&#x3b1;,17 dihydroxy-3-oxo phyllocladane), a phyllocladane diterpenoid with the plant growth regulating properties, from plant genus

Process for the isolation of calliterpenone

The present invention relates to an alpha-arteether resistance domain (ADR) of Sequence ID No.1 and a method of identifying ADR in alpha-arteether resistant pathogens and lastly, it relates to set three pairs of primers of sequence ID Nos. 3 to 8.

Alpha arteether resistance domain

The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plantshaving high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Primers and a screening method for identification of artemisinin producing plants

The present invention relates to a cultivar of'CIM-Jeevan', producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through &#x3b3;-irradiation of superior germplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.

The present invention provides an improved process for the isolation of oleane compounds from the bark of(Roxb.). More particularly, the present invention relates to an improved process for the isolation of arjunic acid and its derivates from the bark of(Roxb.). The present invention further provides the identification of arjunic acid [1] and its derivatives as anticancer agent useful in the treatment of various types of cancer in humans.

Process for the isolation of oleane compounds isolated from the bark of arjun tree terminalia arjuna (Roxb.)

Indian basil,belongs to the family of Lamiaceae. The essential oil of Indian basil extracted via hydro or steam distillation from the leaves or whole plants is used to flavor foods, dental and oral products, in fragrances, and in traditional rituals and medicines. Extracted essential oil has also been shown to contain biologically active constituents that are insecticidal, nematicidal, fungistatic or which have antimicrobial properties. The present invention relates to the development of an early, short duration, dwarf, high essential oil, methy chavicol and linalool yielding variety of Indian basil (). Family&#x2014;Lamiaceae) named as 'CIM-SAUMYA'. This new variety of Indian basil was developed through open pollination in the germplasm followed by half-sib progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions. The new cultivar possesses better growth and vegetative growth and is able to produce higher herbage, oil and better combination of methyl chavicol and linalool yield per unit area as compared to other control genotypes.

The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype ofobtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

High artemisinin yielding artemisia plant named 'CIM-arogya'

The present invention provides an improved preparation based on the synergistic action of garlic extract and essential oil ofvar. Ganga or cinnamon oil against dermatophytic fungus. More particularly, the present invention relates to the synergistic enhancement of activity of a combination by menthyl acetate or Geraniol. The invention also provides a method of preparation of the synergistic combination and the shelf life observed to be more than one year. The cream based preparation is a potent anti-dermatophytic as described and illustrated by in vitro and in vivo evaluations.

Anti-dermatophytic preparation and use thereof

The present invention relates to a method of testingresponse to abiotic stress factors and for testing bioactivity of natural, synthetic and semisynthetic compounds usingplant, which comprises growing the said plant and plant parts aseptically in MS 0 basal medium with agar in microcentrifuge tubes by adding the compounds to be tested either to the culture media or by spraying the said compounds on the plant or plant parts or on the said medium to detect the distinct morphological and cytological responses.

Plant test procedure to detect natural, semi-synthetic, synthetic compounds and physical stress factors through expression of distinct responses

An in vitro screening method for identifying insect tolerant genotypes or clones is described. The method comprises growing plantlets in an in vitro system, screening the plantlets for molecular variation of somaclones using RAPD analysis in vitro, selecting the somaclones having molecular variation, exposing the somaclones to insect larvae or nymphs and identifying the surviving somaclones.

Screening method for selection of insect tolerant plants

The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

Growing community of inventors

Lucknow, India

Suman Preet Singh Khanuja