Council of Scientific and Industrial Research

Shilpi Paul

Suman Preet Singh Khanuja

Ajit Kumar Shasany

Mahendra Pandurang Darokar

Madan Mohan Gupta

Anil Kumar Singh

Rajendra Singh Bhakuni

Raj Kishori Lal

Ravi Prakash Bansal

Ram Kishor Verma

Anil Kumar Gupta

Sudeep Tandon

Ashutosh Kumar Shukla

Govind Ram

Anuruddha Kumar

Anuraddha Kumar

The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plantshaving high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Primers and a screening method for identification of artemisinin producing plants

The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype ofobtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

High artemisinin yielding artemisia plant named 'CIM-arogya'

Growing community of inventors

Lucknow, India

Shilpi Paul