Fondazione Telethon

Salvatore Botta

Enrico Maria Surace

Elena Marrocco

Mariangela Lupo

Nicola De Prisco

The present invention relates to proteins consisting of an artificial DNA-binding domain (DBD) and related molecules and uses thereof. In particular, the proteins are ZF-DBD or TALE-DBD and are used for the treatment of eye disorders caused by gain of function mutation. The disorder may be ADRP, in particular ADRP caused by mutation in the rhodopsin gene. The present invention also relates to a method to identify cis-regulatory elements and to modulate them via DBDs.

Artificial DNA-binding proteins and uses thereof

The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.

Growing community of inventors

Rome, Italy

Salvatore Botta