The University of British Columbia

Teva Pharmaceutical Industries Limited

Simon Fraser University

Paul Rennie

Martin E Gleave

Colleen Nelson

Hideaki Miyake

Artem Tcherkassov

Tobias Zellweger

Robert N Young

Christophe M Andre

Brett P Monia

Fuqiang Ban

Hikeaki Miyake

Sergiy Babiy

Kiyama Satoshi

Anton V Tverdokhlebov

Evgeniia Bogomol

Huifang Li

Kateryna Dunayenko

Eric Joseph Jean LeBlanc

Kush Dalal

Latif Wafa

This invention provides compound having a structure of Formulas:  Uses of such compounds for treatment of various indications, including prostate cancer as well as methods of treatment involving such compounds are also provide.

Binding Function 3 (BF3) site compounds as therapeutics and methods for their use

This invention provides compound having a structure of Formulas: Uses of such compounds for treatment of various indications, including prostate cancer as well as methods of treatment involving such compounds are also provide. 

[object Object]

A compound having the structure of Formula I, wherein A is a substituted or unsubstituted aryl or heteroaryl group, D is a substituted or unsubstituted 5- or 6-membered heteroaryl or heterocyclyl group and E is a substituted or unsubstituted aryl, heteroaryl, cycloalkyl or heterocyclyl group. The compounds are used for the treatment of androgen modulated indications including cancer (prostate, breast, ovarian, endometrial or bladder cancer), hair loss, acne, hirsutism, ovarian cysts, polycystic ovary disease, precocious puberty and age related macular degeneration. The use of the compounds for the manufacture of a medicament for modulating AR activity, a method of treatment using such compounds and a pharmaceutical composition and a commercial package comprising said compounds are also described.

Human androgen receptor DNA-binding domain (DBD) compounds as therapeutics and methods for their use

Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Chemo- and radiation-sensitization of cancer by antisense TRPM-2 oligodeoxynucleotides

A method for treating an individual suffering from a cancer comprising administering to the individual i) a chemotherapeutic agent, and ii) one antisense oligonucleotide having nucleotides in the sequence set forth in Seq. ID No. 4 and which antisense oligonucleotide has a phosphorothioate modification that increases the stability thereof in vivo, wherein the cancer expresses testosterone-repressed prostate message-2 (TRPM-2), thereby treating said individual.

TRPM-2 antisense therapy

It has now been determined that antisense therapy which reduces the expression of TRPM-provides therapeutic benefits in the treatment of cancer. Addition of antisense TRPM-ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Combined use of antisense TRPM-and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-has beneficial effect for other cancer types. Specifically, antisense TRPM-ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than%. Radiation sensitivity is also enhanced when cells expressing TRPM-are treated with antisense TRPM-ODN. Thus, the antisense TRPM-ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-has been observed.

Prostate cancer comes in various forms and has proven difficult to treat. Provided herein are various methods and compositions for treating all forms of prostate cancers with dopa decarboxylase (DDC) inhibitors. These dopa decarboxylase inhibitors include carbidopa (&#x3b1;-Methyl-dopahydrazine), MFMD (&#x3b1;-monofluoromethyldopa), NSD-1015 (3-hydroxybenzylhydrazine), Methyldopa (L-&#x3b1;-Methyl-3,4-dihydroxyphenylalanine) or benserazide, and the inhibitors may be used in combination. DDC inhibitors may also be used to inhibit the progression of prostate cancer to androgen-independence and neuroendocrine prostate cancer.

Treatment of prostate cancer with DDC inhibitor

It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.

It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer for example prostate cancer and renal cell cancer. Antisense TRPM-2 ODN treatment of prostatic tumor cells in vivo is effective for delaying the onset of androgen independence and can be used in combination with androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

It has been determined that antisense therapy which reduces the expression of TRPM-provides therapeutic benefits in the treatment of cancer, particularly prostate and renal cell cancers. Addition of antisense TRPM-ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence, thus prostate cancer can be treated by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in an individual, and administering a composition effective to inhibit expression of TRPM-by the tumor cells. Combined use of antisense TRPM-and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer and in human Renal cell cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-are treated with antisense TRPM-ODN. Thus, the antisense TRPM-ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-has been observed.

Compositions and a method are provided for the treatment of prostate and other endocrine tumors in mammals, including humans, by administration of an antisense oligodeoxynucleotide (ODN) which is complementary to a portion of the gene encoding IGFBP-2. Using the Shionogi tumor model in vitro and in vivo, the administration of such an ODN was shown to reduce proliferation of tumor cells, and also to delay the progression to androgen independence. Thus, treatment of prostate and other hormone-regulated cancer in mammals, including humans, and delay of the progression of prostate tumors to androgen independence is accomplished by administering to the mammal a therapeutically effective amount of an antisense oligodeoxynucleotide which is complementary to a portion of the nucleic acid sequence encoding IGFBP-2 and which reduces the amount of IGFBP-2 in the treated cells.

Growing community of inventors

Richmond, CA, United States of America

Paul Rennie