Stellenbosch University

Nicolaas Francois Visser Burger

Hendrik Willem Swiegers

Anna-Maria Botha-oberholster

The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA ofcprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog ofcprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5′ UAAACAAUCGCAAGAAGCUGA 3′ (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5′ AGCUUCUUGCGAUUGUUUAAG 3′ (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Growing community of inventors

Somerset West, South Africa

Nicolaas Francois Visser Burger