Zhejiang Hisun Pharmaceutical Co., Ltd.

Jiaxing Anyu Biotechnology Co., Ltd.

Zhejiang Hisun Chemical Co., Ltd.

Synwill Co., Ltd.

Na Li

Hua Bai

Ping Chen

Nan Li

Jun Huang

Tingting Zhang

Xintao Zhong

Meihong Li

Linghui Zheng

Jidong Wang

Haibin Wang

Zhen Yu

Peng Sun

Hui Zhang

Lingping Wang

Anliang Chen

Minqi Jin

Jiatan Lin

Aiwen Deng

Yang Song

Feng Jiao

Xiulian Pan

Xinhe Bao

Jun Zhou

Zongming Chang

Acupressure mat set

The invention provides a gene sequence which can encode and express adenovirus hexon protein in vitro, and is represented as SEQ ID NO: 3. Also invented a protein which was translated and expressed by the gene sequence according to the invention, and the invention also relates to the use of the protein as an antigen to immunize rabbits to obtain a polyclonal antibody. The antibody mentioned above can detect adenovirus with high sensitivity and specificity.

Hexon protein hypervariable region gene sequence of adenovirus and its application

The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5'-3&#x2032;) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5&#x2032;-3&#x2032;) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples.

Reagent and method for rapid detection of porcine adenovirus

The invention provides a construction method of spinosad heterologous expression strain, a spinosad heterologous expression strain obtained by the method and use thereof in preparing spinosad. The method utilizes a plurality of homologous recombination to replace the erythromycin synthetic gene cluster ofwith the spinosad synthetic gene cluster and the rhamnose synthetic gene cluster, such that theproduces spinosad.

Spinosad heterologous expression strain and construction method thereof and use

The invention provides a Gene sequence which can encode and express adenovirus hexon protein in vitro, and is represented as SEQ ID NO: 3. Also invented a protein which was translated and expressed by the gene sequence according to the invention, and the invention also relates to the use of the protein as an antigen to immunize rabbits to obtain a polyclonal antibody. The antibody mentioned above can detect adenovirus with high sensitivity and specificity.

The present invention relates to a recombinant microorganism expressing avermectin or analogs thereof and construction method thereof, and also relates to a method of producing avermectin or analogs thereof using the recombinant microorganism, and avermectin or analogs thereof obtained using the method. In addition, the present invention further relates to uses of the avermectin or analogs thereof as insecticides. Using the recombinant microorganism of the present invention to produce avermectin or analogs thereof has numerous advantages, for example comprising at least one of the following: good stability, high yield, simple process, environmentally friendly, and greatly saving of production costs.

Recombinant microorganism expressing avermectin analogue and use thereof

A sixteen-membered macrolide compound and use thereof, the compound structure being represented in formula (I), wherein R is CHor CH. The present compound has a wide range of application in the preparation of chemicals for preventing and controlling insect pests and mites of agriculture and forestry. 

Sixteen-membered macrolide compound and applications thereof

Growing community of inventors

Zhejiang, China

Na Li