The Green Cross Corporation

Masami Miura

Takao Ohmura

Haruhide Kawabe

Ryuji Hiramatsu

Hideyuki Ohi

Hideyuki Oi

Koji Murakami

Ken Okabayashi

Shusei Uno

Yutaka Ishida

Yukimitsu Nakagawa

Kazumoto Hirabayashi

Masako Chuganji

Miho Shimizu

A plasmid for a yeast host, the plasmid comprising in sequence: (1) a yeast derived promoter, (2) an albumin-encoding region placed under control of the yeast-derived promoter, (3) a transcription terminator and (4) a sequence homologous to a part of the yeast host chromosomal sequence such that the plasmid is capable of being integrated into the yeast host cell chromosome and wherein the plasmid is incapable of autonomous replication in yeast cells; a yeast host transformed with the above plasmid; a method of producing a yeast transformant which comprises transforming a yeast host by integrating at least two different plasmids each having a sequence homologous to a part of the host yeast chromosomal sequence one at a time into the chromosome of the yeast host cell; and a method of producing albumin which comprises cultivating the above transformant and recovering the thus-produced albumin.

Albumin gene-containing plasmid, transformant carrying same, production

A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Mutant AOX2 promoter, vector carrying same, transformant and production

A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 is deleted, (2) nucleotide(s) is(are) replaced in region(s) in nucleotides 1274-1314, and (3) new oligonucleotide(s) is (are) inserted in region(s) in nucleotides 1274-1314, a vector carrying said mutant AOX2 promoter, a transformant into which said vector has been introduced, and a method for producing a heterologous protein, which comprises cultivating said transformant. The promoter of the present invention has remarkably enhanced activity as compared with natural AOX2 promoter, and is highly useful as a promoter to be carried in an expression vector allowing heterologous protein expression. In addition, the vector and the transformant of the invention can efficiently express and produce various useful heterologous proteins.

Mutant AOX2 promoter, vector carrying same, transformant, and production

A mutant AOX2 (alcohol oxidase 2) promoter derived from the natural AOX2 promoter by base sequence deletion, insertion, or substitution is disclosed. A microbial strain carrying a gene under the control of such a mutant AOX2 promoter can be obtained by growing in a methanol-containing medium a strain incapable of producing AOX encoded by the AOX1 gene but carrying the AOX2 gene under the control of the natural AOX2 promoter. A heterologous protein may be produced by cultivating the mutant strain with the desired heterologous protein gene incorporated downstream from the mutant AOX2 promoter. A plasmid carrying the mutant AOX2 promoter is also provided.

Mutant AOX2 promoter, microorganism carrying same, method of preparation

Growing community of inventors

Hirakata, Japan

Masami Miura