Council of Scientific and Industrial Research

Other

Department of Biotechnology

Mahendra Pandurang Darokar

Suman Preet Singh Khanuja

Ajit Kumar Shasany

Sushil Kumar

Tiruppadiripuliyur Ranganathan Santha Kumar

Dharmendra Saikia

Madan Mohan Gupta

Anil Kumar Singh

Janak Raj Bahl

Sunita Dhawan

Nirmal Kumar Patra

Ravi Prakash Bansal

Vivek Kumar Gupta

Alok Kalra

Sunil Kumar Chattopadhyay

Raj Kishori Lal

Suchi Srivastava

Jai Shankar Arya

Monika Singh

Soumya Awasthi

Subhash Chandra Gupta

Prachi Sinha

Arun Kumar Tripathy

Anil Kumar Gupta

Ram Kishor Verma

Om Parkash Dhawan

Ali Arif Naqvi

Krishna Kumar Agarwal

Sarita Satapathy

Dharam Chand Jain

Ajit Kumar Shasney

Mansoor Alam

Sunil Balkrishna Mansinghka

Suresh Haribhau Dawle

Alok Krishna

Sweta Agarwal

Ram Kishore Verma

Ateeque Ahmed

Asish Kumar Bhattacharya

Hemendra Pratap Singh

Sudeep Tandon

Birendra Kumar

Hari Om Misra

Arif Ali Naqvi

Abdul Sattar

Anirban Pal

Samresh Dwivedi

Abdul Samad

Mohammad Zaim

Gopal Rao Mallavarapu

Virendra Kumar Singh Tomar

Srinivas Iyer Ramesh

Soni Gupta

Atique Ahmad

Pushplata Chaturvedi

Ram Prakash Sharma

Rajendra Singh Bhakuni

Vijay Kumar

Atul Prakash Kahol

Shiv Kumar Gupta

Vijay Pal Singh

Harikesh Bahadur Singh

Nareshwar Mengi

Hasan Tanveer

Paltoo Ram

Ved Ram Singh

Santosh Kumar Srivastava

Dharmendra Kumar Rajput

Raja Ram

Suchitra Banerjee

Arvind Singh Negi

Ankur Garg

Jawahar Ram Sharma

Surendra Pratap Singh

Jitendra Pal Singh

Veena Prajapati

Merajuddin Khan

Ashutosh Kumar Shukla

Kambod Singh

Guru Das Bagchi

Aparbal Singh

Arun Kumar Kukreja

Dharani Dhar Patra

Subhash Chandra Singh

Abdul Khaliq

Suman P S Khanuja

Poovappallivadakethil Viswanathan Nair Ajaya Kumar

Subash Chandra Verma

Rajesh Luthra

Laiq Ur Rahman

Usha Yadav

Suman Preet Khanuja

Saudan Singh

Moti Lal Gupta

Ram Chandra

Saba Shahabuddin

Mala Trivedi

Govind Ram

Vikram Singh

Anita Gangwar

The invention provides a simple method for isolation of calliterpenone (16&#x3b1;,17 dihydroxy-3-oxo phyllocladane), a phyllocladane diterpenoid with the plant growth regulating properties, from plant genus

Process for the isolation of calliterpenone

The present invention relates to an alpha-arteether resistance domain (ADR) of Sequence ID No.1 and a method of identifying ADR in alpha-arteether resistant pathogens and lastly, it relates to set three pairs of primers of sequence ID Nos. 3 to 8.

Alpha arteether resistance domain

The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plantshaving high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Primers and a screening method for identification of artemisinin producing plants

The present invention relates to a cultivar of'CIM-Jeevan', producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through &#x3b3;-irradiation of superior germplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.

[object Object]

Indian basil,belongs to the family of Lamiaceae. The essential oil of Indian basil extracted via hydro or steam distillation from the leaves or whole plants is used to flavor foods, dental and oral products, in fragrances, and in traditional rituals and medicines. Extracted essential oil has also been shown to contain biologically active constituents that are insecticidal, nematicidal, fungistatic or which have antimicrobial properties. The present invention relates to the development of an early, short duration, dwarf, high essential oil, methy chavicol and linalool yielding variety of Indian basil (). Family&#x2014;Lamiaceae) named as 'CIM-SAUMYA'. This new variety of Indian basil was developed through open pollination in the germplasm followed by half-sib progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions. The new cultivar possesses better growth and vegetative growth and is able to produce higher herbage, oil and better combination of methyl chavicol and linalool yield per unit area as compared to other control genotypes.

The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype ofobtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

High artemisinin yielding artemisia plant named 'CIM-arogya'

The present invention provides an improved preparation based on the synergistic action of garlic extract and essential oil ofvar. Ganga or cinnamon oil against dermatophytic fungus. More particularly, the present invention relates to the synergistic enhancement of activity of a combination by menthyl acetate or Geraniol. The invention also provides a method of preparation of the synergistic combination and the shelf life observed to be more than one year. The cream based preparation is a potent anti-dermatophytic as described and illustrated by in vitro and in vivo evaluations.

Anti-dermatophytic preparation and use thereof

The present invention relates to a method of testingresponse to abiotic stress factors and for testing bioactivity of natural, synthetic and semisynthetic compounds usingplant, which comprises growing the said plant and plant parts aseptically in MS 0 basal medium with agar in microcentrifuge tubes by adding the compounds to be tested either to the culture media or by spraying the said compounds on the plant or plant parts or on the said medium to detect the distinct morphological and cytological responses.

Plant test procedure to detect natural, semi-synthetic, synthetic compounds and physical stress factors through expression of distinct responses

An in vitro screening method for identifying insect tolerant genotypes or clones is described. The method comprises growing plantlets in an in vitro system, screening the plantlets for molecular variation of somaclones using RAPD analysis in vitro, selecting the somaclones having molecular variation, exposing the somaclones to insect larvae or nymphs and identifying the surviving somaclones.

Screening method for selection of insect tolerant plants

The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

The present invention relates to the selection and development of superior strain ofspp for improving plant growth and health by inhibiting pathogenic fungi.

This invention provides a plant growth regulatory activity of a new biologically active synthetic molecule methanone-(3',4&#x2032;,5&#x2032;-trimethoxy) phenyl, 1-naphthyl, 2-O-4&#x2033;-ethyl but-2&#x2033;-enoate. More particularly, the invention relates to the potent plant growth promoting activity of a gallic acid derivative having a structure represented by Formula 1 and a molecular formulae CHO. This invention also provides a novel process for preparation of said molecule from a naturally occurring compound and testing it for growth regulating activity using Bacopa test system developed at CIMAP (Khanuja et al., 2001) 

Gallic acid derivative and process of preparing the same

The present invention relates to the development of a novel multiutility vigorously growing robust mint plant 'Ganga' ofL. var.producing essential oil exhibiting anti-insect and anti-microbial activities and useful for agrochemical and pharmaceutical purposes.

Mint plant Mentha spicata L. var.viridis christened as 'Ganga'

The present invention was related to the development of a novel, distinct high yielding plant with rapid regeneration ability obtained through screening of the somaclones in a methodical way for fast regeneration in the tissue culture stage itself which was achieved by inventing the plant 'Kushal'. The plant yield higher herbage with corresponding high essential oil when evaluated with available superior varieties of mint in late planting condition during April when the fields are vacated after the harvest of Rabi crop like wheat, chickpea, coriander etc. Further the suckers required for commercial vegetative planting can be produced even in low land condition as the plant is reasonably tolerant to water logging compared to the best check 'Kosi'.

Mint plant 'Kushal' for late transplanting

The present invention relates to a new and distinct mint plant of'Cim Indus', selected through screening, field trial and analysis of monoterpene constituents of the essential oil of the germplasm, possessing the characters of producing high amount of menthofuran ranging between 22 to 30% of total oil content, high amount pulegone ranging between 9.0 to 18% of total oil content, with essential oil content ranging between 0.32 to 0.40% of the total oil content.

Mint plant named 'Cim Indus'

Growing community of inventors

Lucknow, India

Mahendra Pandurang Darokar