Council of Scientific and Industrial Research

Madan Mohan Gupta

Suman Preet Singh Khanuja

Mahendra Pandurang Darokar

Sushil Kumar

Ajit Kumar Shasany

Ram Kishor Verma

Monika Singh

Atul Prakash Kahol

Anil Kumar Gupta

Sudeep Tandon

Subhash Chandra Gupta

Dharam Chand Jain

Raj Kishori Lal

Vivek Kumar Gupta

Shiv Kumar Gupta

Jai Shankar Arya

Santosh Kumar Srivastava

Prachi Sinha

Soumya Awasthi

Suresh Haribhau Dawle

Sunil Balkrishna Mansinghka

Ram Kishore Verma

Sweta Agarwal

Tiruppadiripuliyur Ranganathan Santha Kumar

Alok Kalra

Anil Kumar Singh

Dharmendra Saikia

Rajendra Singh Bhakuni

Ravi Prakash Bansal

Mansoor Alam

Anirban Pal

Digvijay Singh

Govind Ram

Subash Chandra Verma

Shilpi Paul

Janak Raj Bahl

Hemendra Pratap Singh

Suchi Srivastava

Om Parkash Dhawan

Ajit Kumar Shasney

Tarun Kumar Singh

Hari Om Misra

Abdul Sattar

Surendra Pratap Singh

Chandeshwar Nath

Samresh Dwivedi

Merajuddin Khan

Jawahar Ram Sharma

Girish Chandra Uniyal

Mohammad Zaim

Abdul Samad

Guru Das Bagchi

Amit Tewari

Subhash Chandra Singh

Arun Kumar Kukreja

Mala Trivedi

Saba Shahabuddin

Rajesh Luthra

Suman Preet Khanuja

Janardan Singh

Ashutosh Kumar Shukla

Ashok Kumar Agrawal

Anuraddha Kumar

Vinay Kumar Khanna

Jai Shanker Arya

Mahendra Panduranga Darokar

Neerja Pant

Shikha Gupta

Raghavendra Narayan Rao Kulkarni

Kuppusamy Baskaran

Ravoor Shankara Rao Chandrashekara

Dnyaneshwar Umrao Bawankule

Anupam Maurya

Arvind Kumar Tripathy

Deeptanjali Sahoo

Guru Das Bagachi

Anuruddha Kumar

Neeraj Jain

Ankur Grag

Harpreet Kaur

Ranganathan Santha Kumar Tiruppadiripuliyur

Raghavendra Kumar Mishra

Subash Chandra Singh

The present invention relates to bioactive extracts its fractions and isolation of compound from. The extracts and fractions are useful for the treatment of psychosis based on in-vivo validation on animal model and proportional binding affinities for dopaminergic-D, Cholinergic (muscarinic) and Serotonergic (5HT) receptors for antipsychotic activity. The present invention relates to novel antipsychotic activity in the leaf alkaloids of Formula 1 and 2 named tetrahydroalstonine, 10-methoxytetrahydroalstonine, isoreserpiline, 10-demethoxyreserpiline, 11-demethoxyreserpiline, reserpiline and &#x3b1;-yohimbine. The present invention also relates to processes for obtaining antipsychotic extracts as well as for the isolation of alkaloids of formula 1 and 2 from the leaves of. The present invention particularly relates to significant antipsychotic activity in the MeOH extract, ethylacetate and chloroform fractions ofand in the isolated compounds &#x3b1;-yohimbine, reserpiline and in a mixture 10-demethoxyreserpiline and 11-demethoxyreserpiline in 1:1.5 ratios for treating psychosis without any extra pyramidal symptoms (EPS). 

[object Object]

The invention provides a simple method for isolation of calliterpenone (16&#x3b1;,17 dihydroxy-3-oxo phyllocladane), a phyllocladane diterpenoid with the plant growth regulating properties, from plant genus

Process for the isolation of calliterpenone

The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plantshaving high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Primers and a screening method for identification of artemisinin producing plants

The present invention relates to a cultivar of'CIM-Jeevan', producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through &#x3b3;-irradiation of superior germplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.

The present invention provides an improved process for the isolation of oleane compounds from the bark of(Roxb.). More particularly, the present invention relates to an improved process for the isolation of arjunic acid and its derivates from the bark of(Roxb.). The present invention further provides the identification of arjunic acid [1] and its derivatives as anticancer agent useful in the treatment of various types of cancer in humans.

Process for the isolation of oleane compounds isolated from the bark of arjun tree terminalia arjuna (Roxb.)

The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype ofobtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

High artemisinin yielding artemisia plant named 'CIM-arogya'

The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

Use of bioactive fraction from cow urine distillate ('go-mutra') as a bio-enhancer of anti-infective, anti-cancer agents and nutrients

The present invention relates to a novel nitrile glycoside of Formula I named NIAZIRIDIN and to analogues and derivatives thereof. The present invention also relates to a process for the isolation of a novel nitrile glycoside of Formula I below named NIAZIRIDIN and its derivatives and analogues by bioactivity-guided fractionation from the pods ofThe present invention particularly relates to the bioenhancing activity of the novel nitrile glycoside of Formula I below named NIAZIRIDIN and its derivatives and analogues in enhancing bioactivity of commonly used antibiotics such as rifampicin, tetracycline and ampicillin against Gram (+) and (&#x2212;) bacteria. The biomolecule also enhances the absorption of drugs, vitamins and nutrients through the gastro-intestinal membrane increasing their bio-availability. Therefore niaziridin can be used in combination therapy with drugs and nutrients resulting in reduced drug associated toxicity, reduced cost and duration of chemotherapy.

Nitrile glycoside useful as a bioenhancer of drugs and nutrients, process of its isolation from moringa oleifera

The present invention provides a novel process for the preparation of bacosides enriched fraction in a non-hygroscopic form the extract of , the said process comprising the steps of drying freshly harvested herb in a hot air oven at 37-42&deg; C., powdering and sieving the dried herb to obtain powder of 30-40 mesh size, defatting the powdered herb with hexane in a modified soxhlet extractor, extracting the defatted powdered herb with acetone, again extracting the same herb with methanol to obtain an extract containing bacosides, concentrating the extract to one twentieth of its original volume under reduced pressure, gradually adding the concentrated extract to acetone for precipitating the bacosides, filtering the bacosides in a Nutsche type vacuum filter, dissolving the crude bacoside mass into 2-10 parts water, extracting the bacoside solution with n-butanol to selectively transfer the bacosides to the solvent phase, separating and concentrating the solvent phase under vacuum to obtain semi-dry mass, dissolving the semi dried mass into 2-10 parts water, adding and stirring 1-5% of &bgr;-cyclodextrin to stabilize the bacosides, spray drying the stabilized bacoside solution by maintaining hot air temperature at 90-110&deg; C., to obtain a stable free flowing fraction of rich in bacosides.

Process for the preparation of a extract rich in bacosides from the herb Bacopa monniera

The present invention relates to a process for the isolation of artemisinin, an antimalarial agent from the herb of the plant, comprising of extracting the herb with ethanol, partitioning of the extract between water and hexane, followed by evaporative crystallization of artemisinin from hexane phase to produce substantially pure artemisinin.

Process for isolating artemisinin from Artemisia annua

The present invention relates a hexane bioactive fraction and obtained from the roots of an aromatic plant named commonly found in India for inhibiting the growth of drug resistant bacterial infections in humans and animals; also relates to a pharmaceutical composition comprising the bioactive extract with other additives for inhibiting the growth of drug resistant bacterial infections in humans and animals and a process for the isolation of said bioactive extract

Bioactive hexane fraction from Vetiveria zizanioides

The invention relates to the development of a new and distinct mutant 'Dhawal' of periwinkle, , produced by chemical mutagen treatment of the seeds followed by rigorous selection in a widely cultivated variety 'Nirmal' of , said plant being stable, homozygous and produces conspicuously higher herbage and alkaloid yield.

'Dhawal', a high alkaloid producing periwinkle plant

The invention relates to a disease resistant and high yielding variety of opium poppy plant ( L. 2 &equals;22) christened as 'Rakshit'.

Method of producing a poppy plant

A pharmaceutical composition comprising an antibiotic and cow urine distillate in an amount effective to enhance antimicrobial effect of the antibiotic is disclosed. The antibiotic can be an antifungal agent. The antibiotic can be a quinolone or a fluoroquinolone. The antifungal agent can be azoles, clotrimazole, mystatin or amphotericin.

Pharmaceutical composition containing cow urine distillate and an antibiotic

Growing community of inventors

Lucknow, India

Madan Mohan Gupta