Consiglio Nazionale Delle Ricerche

Consiglio Nazionale Delle Richerche

Commissariat a L'energie Atomique Et Aux Energies Alternatives

Laura Cerchia

Vittorio De Franciscis

Frédéric Duconge

Gerolama Condorelli

Domenico Libri

Nuclease-resistant RNA aptamers are provided which are capable of neutralizing PDGFR&#x3b2; and are therefore useful in the diagnosis and/or therapy of PDGFR&#x3b2;-associated and hyperproliferative-associated diseases, such as cancer and primary tumor metastasis. RNA aptamers provided herein include a modified synthetic RNA sequence wherein at least one pyrimidine residue is modified to 2'-fluoropyrimidine. Pharmaceutical compositions and diagnostic kits comprising RNA aptamers are also provided.

Neutralizing RNA aptamers

The present invention concerns a nucleotide aptamer having the sequence 5' GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3&#x2032; (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.

EGFR aptamer inhibitor for use in therapy and diagnosis

The present invention concerns a nucleotide aptamer having the sequence: 5'-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3&#x2032;(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.

Axl receptor tyrosine kinase aptamer inhibitor for use in therapy

The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for therapeutic, diagnostic and prognostic purposes.

Growing community of inventors

Naples, Italy

Laura Cerchia