The Green Cross Corporation

Komatsu Corporation

Hideyuki Ohi

Takao Ohmura

Ryuji Hiramatsu

Masami Miura

Kozo Okuda

Shusei Uno

Masako Chuganji

A reducing agent tank includes a tank body storing reducing agent and a cylindrical gauge member visually indicating a storage amount of the reducing agent inside the tank body. The gauge member is in communication with an inside of the tank body. The tank body has a replenishment port to replenish the reducing agent. The gauge member is provided on a first wall surface of a plurality of wall surfaces defining the tank body. The gauge member is provided in a slanted manner relative to a bottom plate of the tank body. The replenishing port and the gauge member are disposed in a row along a direction that extends along the first wall surface as seen in a plan view.

Reducing agent tank and work vehicle

A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying the promoter, a transformant into which the vector has been introduced and a method for producing a heterologous protein, comprising culture of the transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

Mutant AOX2 promoter, vector carrying same, transformant and production

A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 is deleted, (2) nucleotide(s) is(are) replaced in region(s) in nucleotides 1274-1314, and (3) new oligonucleotide(s) is (are) inserted in region(s) in nucleotides 1274-1314, a vector carrying said mutant AOX2 promoter, a transformant into which said vector has been introduced, and a method for producing a heterologous protein, which comprises cultivating said transformant. The promoter of the present invention has remarkably enhanced activity as compared with natural AOX2 promoter, and is highly useful as a promoter to be carried in an expression vector allowing heterologous protein expression. In addition, the vector and the transformant of the invention can efficiently express and produce various useful heterologous proteins.

Mutant AOX2 promoter, vector carrying same, transformant, and production

Growing community of inventors

Hirakata, Japan

Hideyuki Ohi