University of British Columbia

Teva Pharmaceutical Industries Limited

Hideaki Miyake

Martin E Gleave

Paul Rennie

Colleen Nelson

Tobias Zellweger

Brett P Monia

Gleave Martin

Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents.

Chemo- and radiation-sensitization of cancer by antisense TRPM-2 oligodeoxynucleotides

A method for treating an individual suffering from a cancer comprising administering to the individual i) a chemotherapeutic agent, and ii) one antisense oligonucleotide having nucleotides in the sequence set forth in Seq. ID No. 4 and which antisense oligonucleotide has a phosphorothioate modification that increases the stability thereof in vivo, wherein the cancer expresses testosterone-repressed prostate message-2 (TRPM-2), thereby treating said individual.

TRPM-2 antisense therapy

It has now been determined that antisense therapy which reduces the expression of TRPM-provides therapeutic benefits in the treatment of cancer. Addition of antisense TRPM-ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Combined use of antisense TRPM-and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-has beneficial effect for other cancer types. Specifically, antisense TRPM-ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than%. Radiation sensitivity is also enhanced when cells expressing TRPM-are treated with antisense TRPM-ODN. Thus, the antisense TRPM-ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-has been observed.

It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.

It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer for example prostate cancer and renal cell cancer. Antisense TRPM-2 ODN treatment of prostatic tumor cells in vivo is effective for delaying the onset of androgen independence and can be used in combination with androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed.

A method is provided for treating hormone-regulated tumors (for example, breast and prostatic tumors) in mammals, including humans, by administration of an antisense ODN which is complementary to a portion of the gene encoding IGFBP-5. Using the Shionogi tumor model in vitro and in vivo, the administration of such an ODN was shown to reduce proliferation of tumor cells, and also to delay the progression to androgen independence. Thus, treatment of prostate cancer in mammals, including humans, and delay of the progression of prostate tumors to androgen independence is accomplished by administering to the mammal a therapeutically effective amount of an antisense oligodeoxynucleotide which is complementary to a portion of the nucleic acid sequence encoding IGFBP-5 and which hybridizes with such a sequence to inhibit expression of IGFBP-5. Specific antisense ODN's which are suitable for use in the method are GACCACGCTGATCACCAT (Seq. ID. No. 1), which is derived from the murine gene sequence, and CGCCGTGAGCAACACCAT (Seq. ID. No. 3) and AGGTCATGCACCAGCCGC (Seq. ID No. 4), which are derived from the human gene sequence.

Antisense therapy for hormone-regulated tumors

It has been determined that antisense therapy which reduces the expression of TRPM-provides therapeutic benefits in the treatment of cancer, particularly prostate and renal cell cancers. Addition of antisense TRPM-ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence, thus prostate cancer can be treated by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in an individual, and administering a composition effective to inhibit expression of TRPM-by the tumor cells. Combined use of antisense TRPM-and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer and in human Renal cell cancer. Radiation sensitivity is also enhanced when cells expressing TRPM-are treated with antisense TRPM-ODN. Thus, the antisense TRPM-ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-has been observed.

A method is provided for treating hormone-regulated tumors (for example, breast and prostatic tumors) in mammals, including humans, by administration of an antisense ODN which is complementary to a portion of the gene encoding IGFBP-5. Using the Shionogi tumor model in vitro and in vivo, the administration of such an ODN was shown to reduce proliferation of tumor cells, and also to delay the progression to androgen independence. Thus, treatment of prostate cancer in mammals, including humans, and delay of the progression of prostate tumors to androgen independence is accomplished by administering to the mammal a therapeutically effective amount of an antisense oligodeoxynucleotide which is complementary to a portion of the nucleic acid sequence encoding IGFBP-5 and which hybridizes with such a sequence to inhibit expression of IGFBP-5. Specific antisense ODN's which are suitable for use in the method are GACCACGCTGATCACCAT (Seq. ID. No. 1), which is derived from the murine gene sequence, and CGCGGTGAGCAACACCAT (Seq. ID. No. 3) and AGGTCATGCAGCAGCCGC (Seq. ID No 4), which are derived from the human gene sequence.

A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2'-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2&#x2032;-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.

Growing community of inventors

Vancouver, Canada

Hideaki Miyake