Commissariat &#xc0; L'&#xc9;nergie Atomique Et Aux &#xc9;nergies Alternatives

Frédéric Duconge

Bertrand Tavitian

Vittorio De Franciscis

Eric Doris

Laura Cerchia

Edmond Gravel

Agnès Cibiel

Nicolas Mackiewicz

Agnes Cibiel

Domenico Libri

The invention relates to polymerized micelles of size inferior to 100 nm for in vivo diagnosis, in particular of cancer. The polymerized micelles of the invention comprise a diagnostic agent and an amphiphilic polymer obtainable by the polymerization of an amphiphilic monomer, said monomer comprising: a lipophilic chain comprising a polymerizable vinylic or diacetylenic group, and a hydrophilic head comprising a polyoxyethylene or polyoxypropylene chain. The invention finds application in the pharmaceutical field, in particular.

Polymerized micelles for diagnosis

The present invention relates to an aptamer comprising a nucleic acid comprising, or consisting of: &#x2014;the sequence ACUGU CCCAG UAUGA CGCGA CUGCU UAGGU GGGAU GUUUC CCAUG CCUCG (SEQ ID NO: 1), or &#x2014;a sequence comprising, or consisting of, at least 25 consecutive nucleotides in a sequence having at least 80% identity with SEQ ID NO: 1, with the proviso that a nucleic acid consisting of this sequence binds to the LAR protein.

LAR protein-specific ligand

The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.

Specific ligand for annexin 2

Growing community of inventors

Sceaux, France

Frédéric Duconge