Hoffmann-la Roche Inc.

Boehringer Mannheim Gmbh

Roche Diagnostics Gmbh

Roche Palo Alto LLC

Roche Glycart Ag

Sanofi-a Ventis Deutschland Gmbh

Roche Diagnostics Operations, Inc.

F. Hoffmann-la Roche Ag

Erhard Kopetzki

Paul Parren

Jan Van De Winkel

Yvo Graus

Frank Rebers

Anne Stern

Kay-Gunnar Stubenrauch

Beat Steiner

Georg Tiefenthaler

Jacques Himber

Martine Van Vugt

Richard Engh

Christian Klein

Ralf Schumacher

Ulrich Goepfert

Adelbert Grossmann

Christian Schantz

Olaf Mundigl

Rainer Rudolph

Klaus-Peter Kuenkele

Hendrik Knoetgen

Robert Huber

Sebastian Fenn

Pablo Umana

Joerg Thomas Regula

Ulrich Brinkmann

Stephan Fischer

Urban Schmitt

Jens Niewoehner

Juergen Michael Schanzer

Friederike Hesse

Josef Endl

Peter Maier

Ekkehard Moessner

Dieter Heindl

Stefan Seeber

Peter Bruenker

Tilman Schlothauer

Sabine Imhof-Jung

Michael Brandt

Rainer Mueller

Dieter Mangold

Stefan Klostermann

Mara Boenitz-Dulat

Michael Jarsch

Peter Sluka

Gerhard Niederfellner

Dorothee Kling

Pamela Strein

Karl-Peter Hopfner

Oliver Ploettner

Wolfram Bode

Martine Vriesema-van Vugt

Klaus Lehnert

Rebecca Croasdale

Helmut Burtscher

Gunther Schumacher

Uwe Michaelis

Peter Michael Huelsmann

Miranda Jansen-Molenaar

Wilma Lau

Rainer M&uuml;ller

Hans Brandstetter

Arno Deger

Ludwig Lehle

Pamela Braemer

Ursula Schwarz

Michael Huelsmann

Harald Duerr

Reiner Schlipfenbacher

Hans-Joachim Guder

Peter Kratzsch

Martin Schatte

Frank Zocher

Frank Geipel

Hubert Bayer

Dorothee Ambrosius

Jan Olaf Stracke

Stephan Glaser

Suryanarayana Sankuratri

Katharina Wartha

Werner Stock

Silke Hansen

Friedrich Popp

Rebecca Croasdale-Wood

G&uuml;nther Schumacher

Dieter Heinrich Wolf

Rainer Gruenbeck

Gether Schumacher

Bernd Schmidt

Petra Ruger

Dominique Ostler

Simone Dethloff

Christoph Hoh

Simone Hoege

Brigitte Kaluza

In the method as reported herein the isolation of nucleic acid segments encoding antibody variable domains and the insertion of the isolated nucleic acid segments in eukaryotic expression plasmids is performed without the intermediate isolation and analysis of clonal intermediate plasmids. Thus, in the method as reported herein the intermediate cloning, isolation and analysis of intermediate plasmids is not required, e.g. by analysis of isolated transformedcells.

Rapid method for cloning and expression of cognate antibody variable gene segments

The combination of a first binding site specifically binding to a target associated with an eye disease and a second binding site specifically binding to a target influencing the retention in the eye a multispecific binder provides for improved intravitreal retention compared to a monospecific binder. The second binding site specifically binds to a compound/molecules found in the extracellular matrix (ECM) in vitreous humor/retina. This compound of the extracellular matrix has to be present in amounts allowing a sufficient loading/dose of the drug to be bound. It has been found that collagen, especially collagen II, is a suitable compound in the ECM in the vitreous humor for this purpose. Thus, herein is reported a multispecific binder comprising a first binding site specifically binding to a therapeutic ocular target, and a second binding site specifically binding to collagen II.

Fusion proteins for ophthalmology with increased eye retention

Herein is reported a nucleic acid comprising in 5' to 3&#x2032; direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5&#x2032; splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3&#x2032; splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3&#x2032; terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Method for selecting polypeptide producing cells

Herein is reported a method for producing an antibody Fc-region conjugate comprising as first component an antibody Fc-region and as second component at least one binding entity that specifically binds to a target using a transpeptidase for enzymatic conjugation of the antibody Fc-region to at least one binding entity.

Method for making antibody Fc-region conjugates comprising at least one binding entity that specifically binds to a target and uses thereof

Herein is reported a method for producing a bispecific antibody comprising the step of incubating

Method for selection and production of tailor-made highly selective and multi-specific targeting entities containing at least two different binding entities and uses thereof

Herein is reported a method for the detection of a sortase in a sample, comprising the following steps:

Activity assay for bond forming enzymes

Herein is reported a method for producing an enzymatic conjugation product of three polypeptides comprising the simultaneous incubation of i) a first polypeptide comprising the amino acid sequence LPXTG (SEQ ID NO: 20, wherein X can be any amino acid residue), a second polypeptide comprising the amino acid sequence LPXTA (SEQ ID NO: 31, wherein X can be any amino acid residue), a third polypeptide that has two N-termini whereby the polypeptide has an oligo-glycine G(m=2 (SEQ ID NO: 22), or 3 (SEQ ID NO: 23), or 4 (SEQ ID NO: 24), or 5 (SEQ ID NO: 25)) amino acid sequence at its first N-terminus and an oligo-alanine A(m=2 (SEQ ID NO: 26), or 3 (SEQ ID NO: 27), or 4 (SEQ ID NO: 28), or 5 (SEQ ID NO: 29)) amino acid sequence at its second N-terminus, a fourth polypeptide with sortase activity whereby the polypeptide is derived fromsortase A, and a fifth polypeptide with sortase activity whereby the polypeptide is derived fromsortase A and the recovering of the conjugate from the reaction mixture.

Enzymatic one-pot reaction for double polypeptide conjugation in a single step

Herein is reported a method for producing a fusion-polypeptide comprising the seeps of a) cultivating a mammalian cell comprising a nucleic acid encoding a variant fusion-polypeptide wherein the amino acid sequence of the fusion-polypeptide has been modified by replacing in a pro-fusion-polypeptide the endogenous protease cleavage site between the pro-peptide and the fusion-polypeptide with an exogenous (with respect to the origins of the parts of the fusion-polypeptide) or artificial protease cleavage site, and b) recovering the fusion-polypeptide or fusion-pro-polypeptide from the cell or the cultivation median and thereby producing the (recombinant) fusion-polypeptide.

Recombinant polypeptide production methods

Fusion proteins for opthalmology with increased eye retention

Herein is reported a method for producing a fusion-polypeptide comprising the steps of a) cultivating a mammalian cell comprising a nucleic acid encoding a variant fusion-polypeptide wherein the amino acid sequence of the fusion-polypeptide has been modified by replacing in a pro-fusion-polypeptide the endogenous protease cleavage site between the pro-peptide and the fusion-polypeptide with an exogenous (with respect to the origins of the parts of the fusion-polypeptide) or artificial protease cleavage site, and b) recovering the fusion-polypeptide or fusion-pro-polypeptide from the cell or the cultivation medium and thereby producing the (recombinant) fusion-polypeptide.

Herein are reported glycosylated repeat-motif-molecule conjugate of the following formula: (repeat-motif-molecule&#x2212;linker)&#x2212;conjugation partner&#x2212;(linker&#x2212;repeat-motif-molecule), wherein n and o are independently of each other and independently for each value of m and p integer values of 0 or 1, and m and p are independently of each other integer values of 0 or 1 or 2 or 3 or 4 or 5 or 6 or 7, and wherein the repeat-motif-molecule conjugate comprises at least one oligosaccharide attached to a glycosylation site. Also reported are encoding nucleic acids and method for producing these repeat-motif-conjugates in mammalian cells.

Glycosylated repeat-motif-molecule conjugates

Herein is reported a method for producing a polypeptide in a prokaryotic cell, comprising the step of cultivating a prokaryotic cell comprising one or more nucleic acids encoding the polypeptide in a chemically defined minimal growth medium and recovering the polypeptide from the prokaryotic cell or the periplasm of the prokaryotic cell or from the medium, wherein the prokaryotic cell is an amino acid auxotrophy cured prokaryotic cell, wherein growth of the amino acid auxotrophy cured prokaryotic cell compared to the non-cured prokaryotic cell under the same cultivation conditions and in the same growth medium requires the supplementation of fewer amino acids to the growth medium, and wherein the chemically defined minimal growth medium is free of the amino acid corresponding to the auxotrophy that has been cured in the auxotrophy cured prokaryotic cell.

Use of an amino acid auxotrophy cured prokaryotic strain for the recombinant production of a polypeptide

The present invention relates to bispecific antibodies, methods for their production, pharmaceutical compositions containing said antibodies, and uses thereof.

Bispecific antibodies

The current invention reports a promoter having the nucleic acid sequence of SEQ ID NO: 02, or SEQ ID NO: 03, or SEQ ID NO: 04, or SEQ ID NO: 06, which is a 5' shortened SV40 promoter with reduced promoter strength especially useful for the limited expression of heterologous polypeptides or selectable markers.

Promoter

Growing community of inventors

Penzberg, Germany

Erhard Kopetzki