Pfizer Corporation

Amgen Fremont Inc.

Other

Coley Pharmaceutical Group, Inc.

Abgenix, Inc.

Coley Pharmaceutical Gmbh

Douglas Charles Hanson

Jose Corvalan

C Geoffrey Davis

Eileen Elliott Mueller

Steven Christopher Gilman

Jeffrey Herbert Hanke

Mark Joseph Neveu

Eugen Uhlmann

Arthur Mertz Krieg

Gary R Schulte

Carl J Goddard

Ulrike Samulowitz

Jose Ramon Corvalan

Eileen Elliot Mueller

José Ramon Corvalan

In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein.

Human monoclonal antibodies to CTLA-4

Methods of treating cancer with human monoclonal antibodies to CTLA-4

Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5' TCGTCGTTTTCGGCGCGCGCCGT 3&#x2032; (SEQ ID NO: 1), in which each C is unmethylated and 3&#x2032; refers to the 3&#x2032; end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-&#x3b3;. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

Combination motif immune stimulatory oligonucleotides with improved activity

In accordance with the present invention, there are provided fully human monoclonal antibodies against human cytotoxic T-lymphocyte antigen 4 (CTLA-4). Nucelotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FR1 and/or CDR1 through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein.

Nucleic acids encoding human monoclonal antibodies to CTLA-4

Methods and host cells for producing human monoclonal antibodies to CTLA-4

Methods for expressing and recovering human monoclonal antibodies to CTLA-4

This invention relates to the use of certain 3-substituted-2-oxindole derivatives to inhibit interleukin-1 biosynthesis in a mammal. This invention also relates to the use of such compounds for treating interleukin-1 mediated disorders and dysfunctions such as bone and connective tissue metabolism disorders and immune dysfunction in a mammal. The methods of this invention comprise administering an interleukin-1 biosynthesis inhibiting amount of the compounds and salts of this invention to such a mammal.

3-substituted-2-oxindole derivatives as inhibitors of interleukin-1

Growing community of inventors

Niantic, CT, United States of America

Douglas Charles Hanson