Council of Scientific and Industrial Research

Other

Department of Biotechnology

Ajit Kumar Shasany

Suman Preet Singh Khanuja

Mahendra Pandurang Darokar

Sushil Kumar

Tiruppadiripuliyur Ranganathan Santha Kumar

Janak Raj Bahl

Madan Mohan Gupta

Dharmendra Saikia

Nirmal Kumar Patra

Anil Kumar Singh

Alok Kalra

Sunita Dhawan

Raj Kishori Lal

Ravi Prakash Bansal

Vivek Kumar Gupta

Jai Shankar Arya

Monika Singh

Suchi Srivastava

Ali Arif Naqvi

Arif Ali Naqvi

Arun Kumar Tripathy

Soumya Awasthi

Subhash Chandra Gupta

Hemendra Pratap Singh

Vijay Pal Singh

Harikesh Bahadur Singh

Sarita Satapathy

Kambod Singh

Dharam Chand Jain

Ram Kishor Verma

Om Parkash Dhawan

Nareshwar Mengi

Hasan Tanveer

Anil Kumar Gupta

Paltoo Ram

Ved Ram Singh

Birendra Kumar

Mansoor Alam

Hari Om Misra

Sunil Balkrishna Mansinghka

Suresh Haribhau Dawle

Prachi Sinha

Abdul Sattar

Alok Krishna

Sweta Agarwal

Virendra Kumar Singh Tomar

Ram Kishore Verma

Rajendra Singh Bhakuni

Asish Kumar Bhattacharya

Vijay Kumar

Krishna Kumar Agarwal

Raja Ram

Dharmendra Kumar Rajput

Anirban Pal

Jitendra Pal Singh

Jawahar Ram Sharma

Abdul Samad

Gopal Rao Mallavarapu

Mohammad Zaim

Aparbal Singh

Abdul Khaliq

Nilakshi Singh

Poovappallivadakethil Viswanathan Nair Ajaya Kumar

Suman Preet Khanuja

Soni Gupta

Saudan Singh

Atique Ahmad

Pushplata Chaturvedi

Shilpi Paul

Ram Prakash Sharma

Shiv Kumar Gupta

Santosh Kumar Srivastava

Sudeep Tandon

Man Mohan Singh

Suchitra Banerjee

Arvind Singh Negi

Ankur Garg

Samresh Dwivedi

Surendra Pratap Singh

Veena Prajapati

Guru Das Bagchi

Umesh Chandra Lavania

Girish Chandra Uniyal

Bali Ram Tyagi

Subhash Chandra Singh

Dharani Dhar Patra

Rakesh Pandey

Ateeque Ahmed

Suman P S Khanuja

Subash Chandra Verma

Ram Ujagir

Dinesh Kumar

Laiq Ur Rahman

Arun Prasad

Usha Yadav

Moti Lal Gupta

Ram Chandra

Govind Ram

Harmesh Singh Chauhan

Saba Shahabuddin

The present invention relates to the development of high viridiflorol containing variety for enhancing the aroma as well as medicinal properties ofby overexpressing MPTPS4 gene through genetic transformation. This transgenic plant possesses better growth and able to produce essential oil with good quality contains high viridiflorol maximum of about 25% and proportionate decrease in menthone, menthofuran and menthol ofas compared to other control genotype.(CIM-madhuras) that produces viridiflorol, a molecule of potential demand in perfumery, cosmetics, toiletries, drugs and sanitation products.

Method for increasing viridiflorol content in tissues

The present invention relates to the development of a novel, morphologically and genetically distinct khusinol rich essential oil producing clone of vetiver [(L.) Nash. syn.(L.) Roberty; family Poacaeae} named 'CIMAP-Khusinolika'. The plant of this clone is characterized by spreading type clump canopy in the initial stage, white feathery stigma and capable of producing &#x3e;1% (v/w) essential oil containing 45-50% Khusinol (v/v) obtained after hydro-distillation from fresh roots harvested from 6 month old plantations. This clone has unique ISSR profiles that serve as DNA-fingerprints. The clone was obtained through recurrent selection in polycrossed population generated from the bulk of wild collection, and can be propagated through vegetative slips (3 to 6 month old stem with few roots) for commercial plantation as a short duration crop.

Vetiver plant named 'CIMAP-KHUSINOLIKA'

The present invention relates to an alpha-arteether resistance domain (ADR) of Sequence ID No.1 and a method of identifying ADR in alpha-arteether resistant pathogens and lastly, it relates to set three pairs of primers of sequence ID Nos. 3 to 8.

Alpha arteether resistance domain

The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plantshaving high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

Primers and a screening method for identification of artemisinin producing plants

The present invention relates to a cultivar of'CIM-Jeevan', producing high amount of herb, phyllanthin and hypophyllanthin, wherein said cultivar is developed through &#x3b3;-irradiation of superior germplasm, the said plant produces high amount of herbage yield ranging between 1.0-1.15 kg per sqm fresh total plant herb, possesses high vegetative erect growth with a height ranging between 60 to 65 cm, produces phyllanthin ranging between 0.70-0.77% in dry herb, produces hypophyllanthin ranging between 0.32-0.37% in dry herb, and shows seed germination of about 90%.

[object Object]

Indian basil,belongs to the family of Lamiaceae. The essential oil of Indian basil extracted via hydro or steam distillation from the leaves or whole plants is used to flavor foods, dental and oral products, in fragrances, and in traditional rituals and medicines. Extracted essential oil has also been shown to contain biologically active constituents that are insecticidal, nematicidal, fungistatic or which have antimicrobial properties. The present invention relates to the development of an early, short duration, dwarf, high essential oil, methy chavicol and linalool yielding variety of Indian basil (). Family&#x2014;Lamiaceae) named as 'CIM-SAUMYA'. This new variety of Indian basil was developed through open pollination in the germplasm followed by half-sib progeny selection and evaluation for the yield characters of selected population for 3 years in field conditions. The new cultivar possesses better growth and vegetative growth and is able to produce higher herbage, oil and better combination of methyl chavicol and linalool yield per unit area as compared to other control genotypes.

The present invention is related to the development of a novel, distinct high herb and artemisinin yielding genotype ofobtained through systematic marker assisted breeding followed by selection of uniform population in a methodical way wherein the genotype is distinct, uniform and stably maintainable by continuous rouging of off types in the population using DNA marker at early seedling stage from nursery itself and suitable for commercial cultivation.

High artemisinin yielding artemisia plant named 'CIM-arogya'

The present invention provides an improved preparation based on the synergistic action of garlic extract and essential oil ofvar. Ganga or cinnamon oil against dermatophytic fungus. More particularly, the present invention relates to the synergistic enhancement of activity of a combination by menthyl acetate or Geraniol. The invention also provides a method of preparation of the synergistic combination and the shelf life observed to be more than one year. The cream based preparation is a potent anti-dermatophytic as described and illustrated by in vitro and in vivo evaluations.

Anti-dermatophytic preparation and use thereof

The present invention relates to a method of testingresponse to abiotic stress factors and for testing bioactivity of natural, synthetic and semisynthetic compounds usingplant, which comprises growing the said plant and plant parts aseptically in MS 0 basal medium with agar in microcentrifuge tubes by adding the compounds to be tested either to the culture media or by spraying the said compounds on the plant or plant parts or on the said medium to detect the distinct morphological and cytological responses.

Plant test procedure to detect natural, semi-synthetic, synthetic compounds and physical stress factors through expression of distinct responses

An in vitro screening method for identifying insect tolerant genotypes or clones is described. The method comprises growing plantlets in an in vitro system, screening the plantlets for molecular variation of somaclones using RAPD analysis in vitro, selecting the somaclones having molecular variation, exposing the somaclones to insect larvae or nymphs and identifying the surviving somaclones.

Screening method for selection of insect tolerant plants

The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and nutraceutic agents, ions and similar molecules which are targeted to the living systems.

The present invention relates to the selection and development of superior strain ofspp for improving plant growth and health by inhibiting pathogenic fungi.

This invention relates to a new distinct early maturing, high seed and husk yielding variety of psyllium () designated as var. 'Mayuri' with the distinct pigment marker of the panicles relatable to the maturity thereby indicating the right harvesting stage to prevent the seed shattering, a problem in psyllium. This variety was developed by mutation breeding (gamma rays irradiation) and propagated by seeds for commercial cultivation. The new variety could be differentiated from the other variety through unique RAPD profile and has been tested for uniformity and stability of characters defined. Psyllium plant 'Mayuri' with stage marker and early maturity.

Plantago ovata plant named 'Mayuri'

This invention provides a plant growth regulatory activity of a new biologically active synthetic molecule methanone-(3',4&#x2032;,5&#x2032;-trimethoxy) phenyl, 1-naphthyl, 2-O-4&#x2033;-ethyl but-2&#x2033;-enoate. More particularly, the invention relates to the potent plant growth promoting activity of a gallic acid derivative having a structure represented by Formula 1 and a molecular formulae CHO. This invention also provides a novel process for preparation of said molecule from a naturally occurring compound and testing it for growth regulating activity using Bacopa test system developed at CIMAP (Khanuja et al., 2001) 

Gallic acid derivative and process of preparing the same

The present invention relates to the development of a novel multiutility vigorously growing robust mint plant 'Ganga' ofL. var.producing essential oil exhibiting anti-insect and anti-microbial activities and useful for agrochemical and pharmaceutical purposes.

Mint plant Mentha spicata L. var.viridis christened as 'Ganga'

Growing community of inventors

Lucknow, India

Ajit Kumar Shasany